Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31669

Mtap2 microtubule-associated protein 2 ( MGI:97175)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31669 EMAGE:31669 EMAGE:31669 EMAGE:31669 EMAGE:31669
euxassay_010013_01 euxassay_010013_02 euxassay_010013_03 euxassay_010013_04 euxassay_010013_05
EMAGE:31669 EMAGE:31669 EMAGE:31669 EMAGE:31669 EMAGE:31669
euxassay_010013_06 euxassay_010013_07 euxassay_010013_08 euxassay_010013_09 euxassay_010013_10
EMAGE:31669 EMAGE:31669 EMAGE:31669 EMAGE:31669 EMAGE:31669
euxassay_010013_11 euxassay_010013_12 euxassay_010013_13 euxassay_010013_14 euxassay_010013_15
EMAGE:31669 EMAGE:31669 EMAGE:31669 EMAGE:31669 EMAGE:31669
euxassay_010013_16 euxassay_010013_17 euxassay_010013_18 euxassay_010013_19 euxassay_010013_20
EMAGE:31669 EMAGE:31669 EMAGE:31669
euxassay_010013_21 euxassay_010013_22 euxassay_010013_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
neural retina
strong strong
regionalstrong expression: see section 01 02 21 22 23
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 05 06 07 16 17 18
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 08 14
spinal cord
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 15
brain
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 05 06 17 18
trigeminal v nerve
moderate moderate
regionalmoderate expression: see section 15
thoracic ganglion
moderate moderate
regionalmoderate expression: see section 09 10 11
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 05 06 07 08 12 13 14 15 16 17
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 02 03 04 05 17 18 19 20
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 07 16
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 16 17 18 19 20 21
cervical ganglion
moderate moderate
regionalmoderate expression: see section 08 15
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31754
Entity Detected:Mtap2, microtubule-associated protein 2 ( MGI:97175)
Sequence:sense strand is shown

>T31754
TCCCTCCCAAGACCTTCCTCCATCCTCCCTCCTCGCAGGGGTGTATCAGGAGACAGGGAGGAGAACTCTT
TCTCTCTGAATAGCTCCATCTCTTCAGCACGACGGACCACCAGGTCAGAACCAATTCGCAGAGCAGGAAA
AAGTGGCACCTCCACACCTACTACCCCTGGATCAACTGCAATCACCCCTGGAACTCCCCCAAGCTACTCT
TCACGTACCCCAGGCACCCCGGGAACCCCGAGCTACCCCAGGACACCAGGAACCCCCAAATCTGGCATCC
TGGTGCCCAGTGAGAAGAAAGTTGCCATCATCCGCACTCCTCCAAAGTCCCCAGCTACTCCTAAGCAGCT
TCGGCTTATTAACCAACCACTGCCGGACCTGAAGAATGTCAAGTCCAAAATCGGATCAACTGACAACATC
AAATACCAGCCTAAGGGGGGTCAGGTACAAATTGTTACTAAGAAGATAGACTTAAGCCATGTGACATCCA
AATGTGGCTCTCTAAAGAACATCCGTCACAGGCCAGGTGGTGGACGTGTGAAAATTGAGAGTGTAAAACT
GGATTTCAAGGAAAAGGCCCAAGCTAAAGTTGGCTCACTTGACAATGCTCACCACGTACCTGGAGGTGGT
AATGTGAAGATTGACAGCCAAAAGTTGAACTTCAGAGAGCATGCAAAGGCCCGGGTAGATCACGGGGCTG
AGATCATCACACAGTCCCCAAGCAGGTCCAGCGTGGCATCACCCCGACGACTCAGCAACGTCTCATCTTC
TGGAAGCATCAACCTGCTCGAATCCCCTCAGCTTGCCACTTTGGC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:6490760), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 58451. Forward Primer - name:058451_F_IRAV93_d11_Mtap2, sequence:TCCCTCCCAAGACCTTCC; Reverse Primer - name:058451_R_SP6_IRAV93_d11_Mtap2, sequence:AGCCAAAGTGGCAAGCT. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_010013 same experiment
 EMAGE:29464 same embryo
 EMAGE:31672 same embryo
 EMAGE:30535 same embryo
 EMAGE:29458 same embryo
 EMAGE:31676 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS