Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31676

Plxna2 plexin A2 ( MGI:107684)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31676 EMAGE:31676 EMAGE:31676 EMAGE:31676 EMAGE:31676
euxassay_010018_01 euxassay_010018_02 euxassay_010018_03 euxassay_010018_04 euxassay_010018_05
EMAGE:31676 EMAGE:31676 EMAGE:31676 EMAGE:31676 EMAGE:31676
euxassay_010018_06 euxassay_010018_07 euxassay_010018_08 euxassay_010018_09 euxassay_010018_10
EMAGE:31676 EMAGE:31676 EMAGE:31676 EMAGE:31676 EMAGE:31676
euxassay_010018_11 euxassay_010018_12 euxassay_010018_13 euxassay_010018_14 euxassay_010018_15
EMAGE:31676 EMAGE:31676 EMAGE:31676 EMAGE:31676 EMAGE:31676
euxassay_010018_16 euxassay_010018_17 euxassay_010018_18 euxassay_010018_19 euxassay_010018_20
EMAGE:31676 EMAGE:31676 EMAGE:31676
euxassay_010018_21 euxassay_010018_22 euxassay_010018_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
spinal cord
strong strong
regionalstrong expression: see section 07 08 09 10 11 moderate expression: see section 12 13 14 15 16
brain
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 17 18 19 20 21 22 23 moderate expression: see section 13 14 15 16 weak expression: see section 12
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31755
Entity Detected:Plxna2, plexin A2 ( MGI:107684)
Sequence:sense strand is shown

>T31755
GAGCGCCCTCAACGAGATCTACTCATATGTCAGCAAGTACAGTGAGGAGCTCATCGGGGCACTAGAGCAG
GATGAACAGGCCCGACGGCAACGACTGGCCTACAAGGTGGAGCATCTCATCAACGCCATGTCCATAGAGA
GCTGAAAGGAAGACATCTTGTTCTTGGAAGAGAGACTCATATAAGCTATCACACTGGCTTCTCAAAAGGA
AAGATGGGATGAGTGAAGGGTATCAGACCCCAGAGCTGGCTATCCTCTGAAACCTCACTGACGGAAGAAG
GAAAGGCTCCTCTGTCAATGGCAGCCATGTTTCATCACAGCCGGTTCCTTCCAGAAGGACAGTGAACACC
ACCCATCACAGTGTGAGCTCAGGACACAACGGGCAAGGAGAAGGTGGCCCTTTAAGCTGAGAGGCTTGAG
CCAGATGGTTCTGCCTCTGTGACTGCTG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:4505411), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 58508. Forward Primer - name:058508_F_IRAV93_h12_Plxna2, sequence:GAGCGCCCTCAACGAGAT; Reverse Primer - name:058508_R_SP6_IRAV93_h12_Plxna2, sequence:GCAGCAGTCACAGAGGC. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_010018 same experiment
 EMAGE:31669 same embryo
 EMAGE:29464 same embryo
 EMAGE:31672 same embryo
 EMAGE:30535 same embryo
 EMAGE:29458 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS