Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31703

Popdc2 popeye domain containing 2 ( MGI:1930150)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31703 EMAGE:31703 EMAGE:31703 EMAGE:31703 EMAGE:31703
euxassay_009265_01 euxassay_009265_02 euxassay_009265_03 euxassay_009265_04 euxassay_009265_05
EMAGE:31703 EMAGE:31703 EMAGE:31703 EMAGE:31703 EMAGE:31703
euxassay_009265_06 euxassay_009265_07 euxassay_009265_08 euxassay_009265_09 euxassay_009265_10
EMAGE:31703 EMAGE:31703 EMAGE:31703 EMAGE:31703 EMAGE:31703
euxassay_009265_11 euxassay_009265_12 euxassay_009265_13 euxassay_009265_14 euxassay_009265_15
EMAGE:31703 EMAGE:31703 EMAGE:31703 EMAGE:31703 EMAGE:31703
euxassay_009265_16 euxassay_009265_17 euxassay_009265_18 euxassay_009265_19 euxassay_009265_20
EMAGE:31703 EMAGE:31703 EMAGE:31703 EMAGE:31703 EMAGE:31703
euxassay_009265_21 euxassay_009265_22 euxassay_009265_23 euxassay_009265_24 euxassay_009265_25
EMAGE:31703
euxassay_009265_26

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
heart ventricle
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19
upper arm rest of mesenchyme
moderate moderate
regionalmoderate expression: see section 21 22
tongue muscle
strong strong
regionalstrong expression: see section 13 14 moderate expression: see section 10 11 12 15 weak expression: see section 16
midgut
weak weak
regionalweak expression: see section 09 10 11 12 13 14 15 16 17 18 19
forearm rest of mesenchyme
moderate moderate
regionalmoderate expression: see section 01 23 24 25 26
bladder
strong strong
regionalstrong expression: see section 10 11 12 13 14
foot
moderate moderate
regionalmoderate expression: see section 21
heart atrium
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 moderate expression: see section 19 20 21 22
leg muscle
moderate moderate
regionalmoderate expression: see section 01 02 03 04
vertebral axis musculature
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26
arm muscle
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 19 20 25 26
lower leg rest of mesenchyme
moderate moderate
regionalmoderate expression: see section 21 22 23 25 26
hindgut
weak weak
regionalweak expression: see section 11
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T593
Entity Detected:Popdc2, popeye domain containing 2 ( MGI:1930150)
Sequence:sense strand is shown

>T593
TCCTCGAGCCTGTTGGCCTACTGGGTGCTTCCCCTGCTGGCTCTCCACTCCGCGTTCTGCCTGGGAACGA
CAGAGAGCAGAATGTGGCTGCTTCGTCCCGTGTTGCTGAAGTTCATGGTGTCGAGTTCCTACTTCCTCTC
AGGACAATGTATGCTGTTTGCTAAGGACTAAATATGAAGACCAGCCTAAGAAAGCCGGAGCCAAAGAGGT
TTACCAGAGCACTGCGGGAGGGACAAGAGCTTCGCTGAGAGAGAGAGAAAGAGAGGAACGAGGAAAAGAA
AAATCCCAAACAACAAACTTAGGCTTTCAAGCTTCCATGAAGTGTACTATGCTCCTGCGTTCTTTCTCAG
AGCCACCGGAAGCATTCCTGCCAGCAAGGTTGCATTGGTAGTGAGAAGCCACCTGGGAGGACAAACTGAC
TGATTTTCCCCTCAGTTTCCTTTGTGGAGACCGTTTTGGAGCCTGCAAAGGCCTCGAGGGCCCCAAAGAT
GAGTGCCAATGGCAGCTCGGTGGCTCAGCTCCTCTGGCAGCCGCCCGTGTGCAGGAGCTGGAAACCGGAT
GTAGAA
Notes:The probe template was PCR amplified from IMAGE:1885553 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1885553 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_009265 same experiment
 EMAGE:29651 same embryo
 EMAGE:29654 same embryo
 EMAGE:31668 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS