Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31705

Cspp1 ( MGI:2681832)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31705 EMAGE:31705 EMAGE:31705 EMAGE:31705 EMAGE:31705
euxassay_011574_01 euxassay_011574_02 euxassay_011574_03 euxassay_011574_04 euxassay_011574_05
EMAGE:31705 EMAGE:31705 EMAGE:31705 EMAGE:31705 EMAGE:31705
euxassay_011574_06 euxassay_011574_07 euxassay_011574_08 euxassay_011574_09 euxassay_011574_10
EMAGE:31705 EMAGE:31705 EMAGE:31705 EMAGE:31705 EMAGE:31705
euxassay_011574_11 euxassay_011574_12 euxassay_011574_13 euxassay_011574_14 euxassay_011574_15
EMAGE:31705 EMAGE:31705 EMAGE:31705 EMAGE:31705 EMAGE:31705
euxassay_011574_16 euxassay_011574_17 euxassay_011574_18 euxassay_011574_19 euxassay_011574_20
EMAGE:31705 EMAGE:31705 EMAGE:31705
euxassay_011574_21 euxassay_011574_22 euxassay_011574_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 14 15
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 02 03 05 17 18 19 20
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 06
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 16 17 18 19 20 21
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 13 14 15 16 17 18
right lung
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15 16 17 18 19 20 21
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 05 16 17
metanephros
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 14 15 16 17 18
spinal cord
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15
brain
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 05 16 17
left lung
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31026
Entity Detected:Cspp1, ( MGI:2681832)
Sequence:sense strand is shown

>T31026
AAGCAGCCAACAACAGCCCAAGGGACCCTTAGGAATTGAATATGGCTTAAGTTTACCGCTTGGAGAAGAT
TATGAACAGAAGAAACATAAATTAAAAGAAGAATTGAGGCAAGATTATAGACGATATCTTACTCAGAAAA
ATTTCCTATCTACTGGTGAAACAGACCCATCTACTCTGGGAGTTTCTCTTCCCATTGATGAGCGGTTATC
TGCCAAGGAAAGATTGAAACTTGAACGCAACCGAGAATACAATCAGTTTCTCAGGGGTAAGGCAGAATCC
ACAGAAAAAGTCAGACAGGTAGAAAAGAATATTGAGCCTAAGAGTCAAAGAAATAAAAACCCTATTAGTC
AAGGTAAATCTGATCTACCTTTACAAATACAGACTGCATACACACATTCAGAGGGACCCTGGCTAAGCCG
GCAAGAGGAGGGCCTGTACCGACAGCTAGATGGTGAAATTGAATTAAGGAGCAGAAGACCGCTTAAACAA
ACAAAGGAAGAAGTAGGCATTTCTGGTGCAGAACATCCAAGCCTTTCTGGCAGCGCTGGTGTCCCAGAGA
GAAGAGCCCGCAGGGCTAACGAGGAGCGGGTGCTTGACAGACAGCATTGCAGAGCCGACCGAGACCCTGG
TGTGAGTGAAGACATGGACGAGAGGTTTAGATTTGAAAGTGATTTTGATAGAAGACTTTTGAGAGTGTAT
ACAAATGGCAGGTATTTACATCTTCACTTTTCTTCTCTGTATTTACTTAATACTGGTGTTTTATAGTTAC
ATTAGGGAAAAGGAGCTTTATTTGATTTACCGTATTTAATTTAGTTATACTGTTTTGTGAAACACCATTT
TATGTGCCATTGAAGGGGGGAGATAAAGAAAACACTCTAAATGGGGACCTTGGTAAAGC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:3995689), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 25561. Forward Primer - name:025561_F_IRAV36-39_D19_4930413O22Rik, sequence:AAGCAGCCAACAACAGCC; Reverse Primer - name:025561_R_SP6_IRAV36-39_D19_4930413O22Rik, sequence:AGCTTTACCAAGGTCCCC. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_011574 same experiment
 EMAGE:31749 same embryo
 EMAGE:31748 same embryo
 EMAGE:29670 same embryo
 EMAGE:31752 same embryo
 EMAGE:29673 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS