Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31716

Cyp2j6 cytochrome P450, family 2, subfamily j, polypeptide 6 ( MGI:1270148)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31716 EMAGE:31716 EMAGE:31716 EMAGE:31716 EMAGE:31716
euxassay_002871_01 euxassay_002871_02 euxassay_002871_03 euxassay_002871_04 euxassay_002871_05
EMAGE:31716 EMAGE:31716 EMAGE:31716 EMAGE:31716 EMAGE:31716
euxassay_002871_06 euxassay_002871_07 euxassay_002871_08 euxassay_002871_09 euxassay_002871_10
EMAGE:31716 EMAGE:31716 EMAGE:31716 EMAGE:31716 EMAGE:31716
euxassay_002871_11 euxassay_002871_12 euxassay_002871_13 euxassay_002871_14 euxassay_002871_15
EMAGE:31716 EMAGE:31716 EMAGE:31716 EMAGE:31716 EMAGE:31716
euxassay_002871_16 euxassay_002871_17 euxassay_002871_18 euxassay_002871_19 euxassay_002871_20
EMAGE:31716 EMAGE:31716 EMAGE:31716 EMAGE:31716
euxassay_002871_21 euxassay_002871_22 euxassay_002871_23 euxassay_002871_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
dorsal root ganglion
weak weak
regionalweak expression: see section 09 10 11 12 16 17 18
esophagus
moderate moderate
regionalmoderate expression: see section 13 14
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 18 19 20 21 22 23
pituitary gland
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15 16
olfactory cortex marginal layer
moderate moderate
regionalmoderate expression: see section 10 11 12 13 16 17 18 19
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 06 07 08 09 18 19 20
kidney calyx
moderate moderate
regionalmoderate expression: see section 07 08 19 20 21 weak expression: see section 09 10 11 18
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 07 19
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1052
Entity Detected:Cyp2j6, cytochrome P450, family 2, subfamily j, polypeptide 6 ( MGI:1270148)
Sequence:sense strand is shown

>T1052
CCTCNANNCTGTTGGCCTACTGGAGAAGGGTGCCCTTGTTGTTAGCACCTGGGACTTGCCGCAGCTCAGA
CCTTCATTCCTCAGACGAACCAGCTGCAGTCCTAGCCATGCTCGCTGCTACCGGCTCCTTGTTAGCCACG
ATCTGGGCAGCGCTCCATCCCAGGACTCTGTTGGTGGCTGCAGTCACCTTCCTGCTTCTGGCTGATTACT
TCAAAAACCGGCGCCCCAAGAACTATCCCCCAGGGCCTTGGGGTCTGCCTTTCGTGGGCAACATATTCCA
GTTGGACTTTGGGCAGCCCCACCTCTCAATCCAGCCGTTGGTGAAGAAATATGGGAATATTTTTAGCCTG
AATCTTGGTGACATAACTTCAGTGGTCATAACTGGACTGCCCTTAATCAAAGAAGCACTTACTCAAATGG
AACAAAACATTATGAATCGTCCTCTAAGTGTTATGCAAGAACGTATATCTAATAAAAATGGATTGATCTT
CTCCAGTGGCCAAATATGGAAGGAGCAAAGAAGGTTTGCCCTGATGACACTGAGGAACTTTGGACTGGGA
AAGAAGAGCT
Notes:The probe template was PCR amplified from IMAGE:2088372 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2088372 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_002871 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS