Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31765

Tmco3 transmembrane and coiled-coil domains 3 ( MGI:2444946)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31765 EMAGE:31765 EMAGE:31765 EMAGE:31765 EMAGE:31765
euxassay_002820_01 euxassay_002820_02 euxassay_002820_03 euxassay_002820_04 euxassay_002820_05
EMAGE:31765 EMAGE:31765 EMAGE:31765 EMAGE:31765 EMAGE:31765
euxassay_002820_06 euxassay_002820_07 euxassay_002820_08 euxassay_002820_09 euxassay_002820_10
EMAGE:31765 EMAGE:31765 EMAGE:31765 EMAGE:31765 EMAGE:31765
euxassay_002820_11 euxassay_002820_12 euxassay_002820_13 euxassay_002820_14 euxassay_002820_15
EMAGE:31765 EMAGE:31765 EMAGE:31765 EMAGE:31765 EMAGE:31765
euxassay_002820_16 euxassay_002820_17 euxassay_002820_18 euxassay_002820_19 euxassay_002820_20
EMAGE:31765 EMAGE:31765 EMAGE:31765 EMAGE:31765
euxassay_002820_21 euxassay_002820_22 euxassay_002820_23 euxassay_002820_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
nucleus pulposus
moderate moderate
regionalmoderate expression: see section 15
ventral grey horn
strong strong
regionalstrong expression: see section 15 moderate expression: see section 12 13 14 weak expression: see section 16 17
medulla oblongata basal plate ventricular layer
strong strong
regionalstrong expression: see section 14
pons ventricular layer
strong strong
regionalstrong expression: see section 13
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2186
Entity Detected:Tmco3, transmembrane and coiled-coil domains 3 ( MGI:2444946)
Sequence:sense strand is shown

>T2186
TGGCCTCGAGCCAGATTCGGATCCTTGGTCTTGTCTCTCATCCTGCCGAGGAGCAGCCAGTACATCAAGT
GGATCGTATCCGCTGGGCTGGCACAGGTCAGCGAGTTCTCCTTTGTCCTGGGGAGTCGAGCACGGAGAGC
AGGCATCCTCTCCAGAGAGGTGTACCTCCTTATCCTAAGTGTGACCACACTCAGCCTCTTACTCGCCCCA
GTGCTGTGGAAAGCAGCCATTACCAAGTGTGTGCCGAGACCAGAGAGGCGCTCAAGTCTCTGACAACACC
CGAGGACGACAGGCTGTGGGGCAAGGATCCTTCGGGGGTTCCAGTCCCGAGACGGTCTGCTGCTGCGCCT
CTCTGCTGGCTTCCCAGCAGAGACAGAGTAACACGGGCCAAGAGGCAGCGCCCTCATGCTTGCTTGCTAT
TTCAAAGACTCTCCTGTCATGTTTAAGAATTTTCCAGAGTAATTTATTTGCAGTCAGTTGATTATGTACA
GAGTTTTAACACTGCATTTTACAATCACCTGAACTATTTTGCCTGGATGTGCCTTTTTTAATGAAAATTA
TTAACTTCCA
Notes:The probe template was PCR amplified from IMAGE:902011 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:902011 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_002820 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS