Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31770

Cycs ( MGI:88578)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31770 EMAGE:31770 EMAGE:31770 EMAGE:31770 EMAGE:31770
euxassay_000644_01 euxassay_000644_02 euxassay_000644_03 euxassay_000644_04 euxassay_000644_05
EMAGE:31770 EMAGE:31770 EMAGE:31770 EMAGE:31770 EMAGE:31770
euxassay_000644_06 euxassay_000644_07 euxassay_000644_08 euxassay_000644_09 euxassay_000644_10
EMAGE:31770 EMAGE:31770 EMAGE:31770 EMAGE:31770 EMAGE:31770
euxassay_000644_11 euxassay_000644_12 euxassay_000644_13 euxassay_000644_14 euxassay_000644_15
EMAGE:31770 EMAGE:31770 EMAGE:31770 EMAGE:31770 EMAGE:31770
euxassay_000644_16 euxassay_000644_17 euxassay_000644_18 euxassay_000644_19 euxassay_000644_20
EMAGE:31770 EMAGE:31770 EMAGE:31770 EMAGE:31770
euxassay_000644_21 euxassay_000644_22 euxassay_000644_23 euxassay_000644_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
ventral grey horn
moderate moderate
regionalmoderate expression: see section 08 10 12 22 23 24
medulla oblongata basal plate ventricular layer
weak weak
regionalweak expression: see section 23 24
kidney calyx
weak weak
homogeneousweak expression: see section 01 02 04 09 13 14 19 20 21 22
chondrocranium
moderate moderate
regionalmoderate expression: see section 03 05 06 07 15 16 17 18
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 02 13 19 20
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 02 04 09 10 12 20 21 22 23
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 01 07 13 14 17 18
meckel's cartilage
weak weak
regionalweak expression: see section 05 06 07 15 16 17 18
lower jaw molar
weak weak
regionalweak expression: see section 01 02 09 13 14 21
medulla oblongata basal plate
weak weak
regionalweak expression: see section 04 08 09 12 21
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 02
upper jaw molar
weak weak
regionalweak expression: see section 01 02 04 09 13 14 21
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 01 02 04 05 07 09 13 14 15 17 18 19 20 21
vibrissa
weak weak
regionalweak expression: see section 01 05 07 14 19 20
liver lobe
weak weak
homogeneousweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
lower jaw incisor
weak weak
regionalweak expression: see section 08 10 12 23 24
upper jaw incisor
weak weak
regionalweak expression: see section 08 10 12 23 24
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T875
Entity Detected:Cycs, ( MGI:88578)
Sequence:sense strand is shown

>T875
TCCTCGAGNCTGTTGGCCTACTGGAGAGCGCGGGACGTCTGTCTTCGAGTCCGAACGTTCGTGGTGTTGA
CCAGCCCGGAACGAATTAAAAATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCC
AGTGCCACACTGTGGAAAAGGGAGGCAAGCATAAGACTGGACCAAATCTCCACGGTCTGTTCGGGCGGAA
GACAGGCCAGGCTGCTGGATTCTCTTACACAGATGCCAACAAGAACAAAGGCATCACCTGGGGAGAGGAT
ACCCTGATGGAGTATTTGGAGAATCCCAAAAAGTACATCCCTGGAACAAAAATGATCTTCGCTGGAATTA
AGAAGAAGGGAGAAAGGGCAGACCTAATAGCTTATCTTAAAAAGGCTACTAATGAGTAATTCCACTGCCT
TATTTATTACAAAACAAATGTCTCATGGCTTTTAATGTACACCATAATTTAATTCACACACCAAATTCAG
ATCATGAATGGCTAGCAATGTTTTTGTTGGACAGTCCTGATTTAAGTAAAACTGACTTGTCATA
Notes:The probe template was PCR amplified from IMAGE:1923779 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1923779 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_000644 same experiment
 EMAGE:30559 same embryo
 EMAGE:31767 same embryo
 EMAGE:30577 same embryo
 EMAGE:31798 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS