Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31777

Fath2 ( MGI:2685369)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31777 EMAGE:31777 EMAGE:31777 EMAGE:31777 EMAGE:31777
euxassay_013722_01 euxassay_013722_02 euxassay_013722_03 euxassay_013722_04 euxassay_013722_05
EMAGE:31777 EMAGE:31777 EMAGE:31777 EMAGE:31777 EMAGE:31777
euxassay_013722_06 euxassay_013722_07 euxassay_013722_08 euxassay_013722_09 euxassay_013722_10
EMAGE:31777 EMAGE:31777 EMAGE:31777 EMAGE:31777 EMAGE:31777
euxassay_013722_11 euxassay_013722_12 euxassay_013722_13 euxassay_013722_14 euxassay_013722_15
EMAGE:31777 EMAGE:31777 EMAGE:31777 EMAGE:31777 EMAGE:31777
euxassay_013722_16 euxassay_013722_17 euxassay_013722_18 euxassay_013722_19 euxassay_013722_20
EMAGE:31777 EMAGE:31777 EMAGE:31777 EMAGE:31777
euxassay_013722_21 euxassay_013722_22 euxassay_013722_23 euxassay_013722_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
oral epithelium
strong strong
regionalstrong expression: see section 06 07 08 11 12 13 14 15 16 17 18 19 20 21 22
stomach
strong strong
regionalstrong expression: see section 06 07 09 10 moderate expression: see section 02 03 04 05
diencephalon meninges
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
urethra of male
moderate moderate
regionalmoderate expression: see section 12 13
rest of cerebellum marginal layer
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 moderate expression: see section 22 weak expression: see section 04
anterior naris epithelium
strong strong
regionalstrong expression: see section 13 17 moderate expression: see section 18
thyroid gland
moderate moderate
regionalmoderate expression: see section 13 17 18 weak expression: see section 12
external naris epithelium
strong strong
regionalstrong expression: see section 13 moderate expression: see section 18
bladder
moderate moderate
regionalmoderate expression: see section 12 13
lower jaw molar
strong strong
regionalstrong expression: see section 09 20 21 moderate expression: see section 07 08
basioccipital bone
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
submandibular gland primordium
strong strong
regionalstrong expression: see section 21 moderate expression: see section 08 09 10 11 18 19 20
upper jaw molar
strong strong
regionalstrong expression: see section 21 moderate expression: see section 07
thymus primordium
moderate moderate
regionalmoderate expression: see section 13 14 15 16 17
naso-lacrimal duct
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 19 20 21 22 23 24
vibrissa
moderate moderate
regionalmoderate expression: see section 03 05 06 07 08 21 22 23 24
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 09 10 11 12 13 20 moderate expression: see section 16 17 18 19
epidermis
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
esophagus epithelium
moderate moderate
regionalmoderate expression: see section 11 12 13 14
pharynx epithelium
moderate moderate
regionalmoderate expression: see section 13 14 15
lower jaw incisor
strong strong
regionalstrong expression: see section 13 16 17
upper jaw incisor
strong strong
regionalstrong expression: see section 13 17
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T37838
Entity Detected:Fath2, ( MGI:2685369)
Sequence:sense strand is shown

>T37838
CATTTCTACCTGAAAACGCTCCAGCCATGGGCCCTTCTGATGTTCACCAATGAAACAGCCTCTATTTCCT
TGAAGCTGGCCAATGGCTTCCTCCATCTGGAATACCGATGCCCTGGTGGTTTCTATGGAAACCTTTCCTC
CCATCGTCCTGTGAATGATGGACAGTGGCACTCCATGCTGTTGGAGGAGAGGGACACTTCTGTTCATCTG
TTGGTCGACATCACAGACAACACTTCCCTTGTCATCCCAGAGGAATGTCAGGGTCTGAGGACTGAGAGAC
ACCTACTGCTGGGTGGCCTTGTCCCCTCAAATCCTTCCTCAAATGTCTCCCTGGGGTTTGAAGGTTGCCT
GGATGCTGTTGTGGTTAACAGTGAGAGGTTAGAGCTGCTTGGCCATAGAAAGAAGATGGCGGGCTACCTA
GAGACATGGGCCCTCAGCCAGTGCTGCTGGCCTGGAACCACCTGCAGCCAGAACCCGTGCCTCAATGGTG
GGAGCTGTTCACCTGCCCTTGGATCAGGATACCTGTGCAGGTGCCCCCCTCTGTTCTCTGGCAGGAACTG
TGAACTTGGAAGGGAGAATTGTACTTCTGCGCCCTGCCAAGAAGGTGGCACATGTGTCTCCTCCCCTGAA
GGCACTTCCTGTAGCTGCCCTCACCCTTACACAGGTGACAGGTGTGAGATGGAAGCAAGGGGTTGTTCTG
GAGGACACTGTCTCATCACTCCTGAGATTAAGAGAGGGGACTGGGGACAGCAGGAGTTCCTGGTAAT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 83571. Forward Primer - name:083571_F_cDNA_LOC245827, sequence:CATTTCTACCTGAAAACGCTCC; Reverse Primer - name:083571_N_SP6_cDNA_LOC245827, sequence:ATTACCAGGAACTCCTGCTGT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_013722 same experiment
 EMAGE:31704 same embryo
 EMAGE:29690 same embryo
 EMAGE:31757 same embryo
 EMAGE:31820 same embryo
 EMAGE:31754 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS