Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31801

Mt1 ( MGI:97171)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31801 EMAGE:31801 EMAGE:31801 EMAGE:31801 EMAGE:31801
euxassay_001746_01 euxassay_001746_02 euxassay_001746_03 euxassay_001746_04 euxassay_001746_05
EMAGE:31801 EMAGE:31801 EMAGE:31801 EMAGE:31801 EMAGE:31801
euxassay_001746_06 euxassay_001746_07 euxassay_001746_08 euxassay_001746_09 euxassay_001746_10
EMAGE:31801 EMAGE:31801 EMAGE:31801 EMAGE:31801 EMAGE:31801
euxassay_001746_11 euxassay_001746_12 euxassay_001746_13 euxassay_001746_14 euxassay_001746_15
EMAGE:31801 EMAGE:31801 EMAGE:31801 EMAGE:31801 EMAGE:31801
euxassay_001746_16 euxassay_001746_17 euxassay_001746_18 euxassay_001746_19 euxassay_001746_20
EMAGE:31801 EMAGE:31801
euxassay_001746_21 euxassay_001746_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
oral epithelium
moderate moderate
spottedmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 weak expression: see section 19
stomach
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09
kidney calyx
moderate moderate
regionalmoderate expression: see section 03 04 15
urethra of male
weak weak
regionalweak expression: see section 12
spinal cord ventricular layer
moderate moderate
regionalmoderate expression: see section 10 weak expression: see section 09
bladder
weak weak
regionalweak expression: see section 12
esophagus
weak weak
regionalweak expression: see section 10 11
pancreas
strong strong
regionalstrong expression: see section 07 08 09
submandibular gland primordium
strong strong
regionalstrong expression: see section 06 07 08 09 15 16 17
pharyngo-tympanic tube
strong strong
regionalstrong expression: see section 22 weak expression: see section 01 02 03 04 05 21
vibrissa
strong strong
regionalstrong expression: see section 07 08 09 19 20
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 09 11 12 14 15 16 17 18 weak expression: see section 19 20 21
nasal cavity olfactory epithelium
weak weak
regionalweak expression: see section 09 10 11 12 14 15 16 17
epidermis
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
liver lobe
strong strong
homogeneousstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2635
Entity Detected:Mt1, ( MGI:97171)
Sequence:sense strand is shown

>T2635
TGGCCTCGAGGCCAGATTCGGACGAGGCTTCTCCTCACTTACTCCGTAGCTCCAGCTTCACCAGATCTCG
GAATGGACCCCAACTGCTCCTGCTCCACCGGCGGCTCCTGCACTTGCACCAGCTCCTGCGCCTGCAAGAA
CTGCAAGTGCACCTCCTGCAAGAAGAGCTGCTGCTCCTGCTGTCCCGTGGGCTGCTCCAAATGTGCCCAG
GGCTGTGTCTGCAAAGGCGCCGCGGACAAGTGCACGTGCTGTGCCTGATGTGACGAACAGCGCTGCCACC
ACGTGTAAATAGTATCGGACCAACCCAGCGTCTTCCTATACAGTTCCACCCTGTTTACTAAACCCCCGTT
TTCTACCGAGTACGTGAATAATAAAAGCCTGTTTGAGTCTAAAAAAAAAAAAAAA
Notes:The probe template was PCR amplified from IMAGE:1400936 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1400936 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_001746 same experiment
 EMAGE:29725 same embryo
 EMAGE:31724 same embryo
 EMAGE:30723 same embryo
 EMAGE:29662 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS