Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31823

Zfp2 zinc finger protein 2 ( MGI:99167)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31823 EMAGE:31823 EMAGE:31823 EMAGE:31823 EMAGE:31823
euxassay_000892_01 euxassay_000892_02 euxassay_000892_03 euxassay_000892_04 euxassay_000892_05
EMAGE:31823 EMAGE:31823 EMAGE:31823 EMAGE:31823 EMAGE:31823
euxassay_000892_06 euxassay_000892_07 euxassay_000892_08 euxassay_000892_09 euxassay_000892_10
EMAGE:31823 EMAGE:31823 EMAGE:31823 EMAGE:31823 EMAGE:31823
euxassay_000892_11 euxassay_000892_12 euxassay_000892_13 euxassay_000892_14 euxassay_000892_15
EMAGE:31823 EMAGE:31823 EMAGE:31823 EMAGE:31823 EMAGE:31823
euxassay_000892_16 euxassay_000892_17 euxassay_000892_18 euxassay_000892_19 euxassay_000892_20
EMAGE:31823 EMAGE:31823 EMAGE:31823
euxassay_000892_21 euxassay_000892_22 euxassay_000892_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
vestibulocochlear viii ganglion vestibular component
strong strong
homogeneousstrong expression: see section 01 12 13 21
superior glossopharyngeal ix ganglion
strong strong
homogeneousstrong expression: see section 11 20
vestibulocochlear viii ganglion cochlear component
strong strong
homogeneousstrong expression: see section 01 02 10 11 18 20 not examined expression: see section 12
inferior glossopharyngeal ix ganglion
strong strong
homogeneousstrong expression: see section 01 10 11 18 20
not examined not examined
homogeneousnot examined expression: see section 01 02 10 11 18 20
not examined not examined
homogeneousnot examined expression: see section 02 03 04 05 06
spinal cord
strong strong
homogeneousstrong expression: see section 02 03 04 05 06 07 08 19 not examined expression: see section 01 09 10 11 12 13
not examined not examined
homogeneousnot examined expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14
glossopharyngeal ix ganglion
strong strong
homogeneousstrong expression: see section 09 not examined expression: see section 01 02 10 11 18 20
telencephalon
strong strong
homogeneousstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
dorsal root ganglion
strong strong
regionalstrong expression: see section 01 02 03 06 07 08 09 10 19 20
facial vii ganglion
strong strong
homogeneousstrong expression: see section 13 14 18 21 22 not examined expression: see section 01
midbrain
strong strong
homogeneousstrong expression: see section 02 03 04 05 06 07 08 09 10 11 12 18 19 20
not examined not examined
homogeneousnot examined expression: see section 01 02 09 10 11 18 20
diencephalon
strong strong
homogeneousstrong expression: see section 02 03 04 05 06 07 08 09 10 11 18 19
trigeminal v ganglion
strong strong
homogeneousstrong expression: see section 01 02 10 11 12 13 14 17 18 20 21 22 23
hindbrain
strong strong
homogeneousstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 18 19 20 21 22
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T174
Entity Detected:Zfp2, zinc finger protein 2 ( MGI:99167)
Sequence:sense strand is shown

>T174
TGAATGTGGAAAGGCATTCAGCCAAAGCGCCTATCTCATTGAACATCAAAGGATTCATACTGGTGAAAAA
CCCTATGAATGTGATCAGTGTGGGAAAGCTTTCATAAAGAACTCATCCCTTATAGTGCACCAGAGGATAC
ATACAGGAGAGAAACCCTATCAGTGCAATGAATGTGGAAAGTCCTTCAGTAGGAGTACAAACCTTACAAG
ACATCAGAGGACTCATACATGAGAAATGCTCTCGTCAACTCCTTCATTTTGTTTAACCTTTTGATACTAA
TCAGATGTCACACTGATGTAGATACTTAGTAAATATAACTAATGTGGTAACTTTTTAGTTGAAGAACAAT
ATAGCATAGCAGATAATAAAATCATAGAGAGTAACCATGTGAAAGTGGAGAACCCTTGATTCAGATTTGA
GTAGCTATGACATAAATAATGAAGCTGTATTTGGTCACACTGGGAAATCTGATTTGGGCATCACAA
Notes:The probe template was PCR amplified from IMAGE:2646150 using vector specific primers. Forward Primer - name:RZ. T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template usi. T7 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2646150 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_000892 same experiment
 EMAGE:30110 same embryo
 EMAGE:31567 same embryo
 EMAGE:31512 same embryo
 EMAGE:30742 same embryo
 EMAGE:31489 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS