Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31912

Olfr1404 ( MGI:3031238)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31912 EMAGE:31912 EMAGE:31912 EMAGE:31912 EMAGE:31912
euxassay_013006_01 euxassay_013006_02 euxassay_013006_03 euxassay_013006_04 euxassay_013006_05
EMAGE:31912 EMAGE:31912 EMAGE:31912 EMAGE:31912 EMAGE:31912
euxassay_013006_06 euxassay_013006_07 euxassay_013006_08 euxassay_013006_09 euxassay_013006_10
EMAGE:31912 EMAGE:31912 EMAGE:31912 EMAGE:31912 EMAGE:31912
euxassay_013006_11 euxassay_013006_12 euxassay_013006_13 euxassay_013006_14 euxassay_013006_15
EMAGE:31912 EMAGE:31912 EMAGE:31912 EMAGE:31912 EMAGE:31912
euxassay_013006_16 euxassay_013006_17 euxassay_013006_18 euxassay_013006_19 euxassay_013006_20
EMAGE:31912 EMAGE:31912 EMAGE:31912
euxassay_013006_21 euxassay_013006_22 euxassay_013006_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
nasal cavity olfactory epithelium
strong strong
single cellstrong expression: see section 09 10 13 14
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T39108
Entity Detected:Olfr1404, ( MGI:3031238)
Sequence:sense strand is shown

>T39108
GATTGCTTTTCGAGACTGTGTGGTCCAGATCTTTTTTTATCTAACTTTTGGCATCAACAACTGTTTCTTA
CTCATGGTCATGGGATATGACCGTTATGTGGCCATTTGCAACCCCCTAAGGTATTCAGTCATCATGGGTA
GGAAGGCTTGTGTCCACTTAGCATCTGGGTCACTGGGAATTGGCCTAGGCATGGCTATAGTCCAAGTTAC
ATCAGTATTTAGCTTGCCCTTCTGTGATAGAT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 152517. Forward Primer - name:152517_F_cDNA_Olfr1404, sequence:GATTGCTTTTCGAGACTGTGTG; Reverse Primer - name:152517_N_SP6_cDNA_Olfr1404, sequence:ATCTATCACAGAAGGGCAAG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_013006 same experiment
 EMAGE:31914 same embryo
 EMAGE:31916 same embryo
 EMAGE:30630 same embryo
 EMAGE:31919 same embryo
 EMAGE:31921 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS