Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31966

Fasn fatty acid synthase ( MGI:95485)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31966 EMAGE:31966 EMAGE:31966 EMAGE:31966 EMAGE:31966
euxassay_013691_01 euxassay_013691_02 euxassay_013691_03 euxassay_013691_04 euxassay_013691_05
EMAGE:31966 EMAGE:31966 EMAGE:31966 EMAGE:31966 EMAGE:31966
euxassay_013691_06 euxassay_013691_07 euxassay_013691_08 euxassay_013691_09 euxassay_013691_10
EMAGE:31966 EMAGE:31966 EMAGE:31966 EMAGE:31966 EMAGE:31966
euxassay_013691_11 euxassay_013691_12 euxassay_013691_13 euxassay_013691_14 euxassay_013691_15
EMAGE:31966 EMAGE:31966 EMAGE:31966 EMAGE:31966 EMAGE:31966
euxassay_013691_16 euxassay_013691_17 euxassay_013691_18 euxassay_013691_19 euxassay_013691_20
EMAGE:31966 EMAGE:31966 EMAGE:31966 EMAGE:31966
euxassay_013691_21 euxassay_013691_22 euxassay_013691_23 euxassay_013691_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 06 19
cervico-thoracic ganglion
strong strong
regionalstrong expression: see section 09 10 moderate expression: see section 16
clavicle
strong strong
regionalstrong expression: see section 10 17 18 moderate expression: see section 09
trigeminal v nerve
strong strong
regionalstrong expression: see section 18
thoracic ganglion
strong strong
regionalstrong expression: see section 13
testis
moderate moderate
regionalmoderate expression: see section 06 07 08 09 weak expression: see section 21 22 23
viscerocranium
moderate moderate
regionalmoderate expression: see section 08 09 10 11 20
otic capsule
weak weak
regionalweak expression: see section 07 08 09 16 17 18
pancreas
weak weak
regionalweak expression: see section 10 11 12
facial vii ganglion
strong strong
regionalstrong expression: see section 04 05 21 22
vagus x ganglion
strong strong
regionalstrong expression: see section 08 17
upper jaw molar
moderate moderate
regionalmoderate expression: see section 20
thymus primordium
weak weak
regionalweak expression: see section 11 12 13 14 15
trigeminal v ganglion
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 18 19 20 21 22 23
vibrissa
strong strong
regionalstrong expression: see section 07 08 09 21 22 23 moderate expression: see section 24
cervical ganglion
strong strong
regionalstrong expression: see section 09 moderate expression: see section 16
orbito-sphenoid
strong strong
regionalstrong expression: see section 04 05 06 23 24 moderate expression: see section 02 03 07 08 09 19 20 22
neural retina
strong strong
regionalstrong expression: see section 01 02 03 04 24
mandible
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 17 18 19 20 21 22 23 24 weak expression: see section 03 04 05 06 07 08
thyroid cartilage
moderate moderate
regionalmoderate expression: see section 11 15 weak expression: see section 12
rib
moderate moderate
regionalmoderate expression: see section 01 02 03 weak expression: see section 04 05 06 07 19 21 22 23 24
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 06 07 18 19
midgut
moderate moderate
regionalmoderate expression: see section 12 13 14 15 16 17 18 19 20 21 22 weak expression: see section 11
thyroid gland
weak weak
regionalweak expression: see section 11 15
dorsal root ganglion
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 16 17 18
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 07 08 09 10 17 18 19 20
renal cortex
weak weak
regionalweak expression: see section 07 08 09 10 11 17 18 19 20 21
maxilla
moderate moderate
regionalmoderate expression: see section 09 10 19 20 21 22 23 weak expression: see section 07 08
adrenal cortex
weak weak
regionalweak expression: see section 08 09 10 17 18 19
lower jaw incisor
strong strong
regionalstrong expression: see section 12 moderate expression: see section 13 14 15 16 17
upper jaw incisor
strong strong
regionalstrong expression: see section 12 moderate expression: see section 13 14 17 18
lung
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 13 14 15 16 17 18 19 20 21 22 23 24
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31707
Entity Detected:Fasn, fatty acid synthase ( MGI:95485)
Sequence:sense strand is shown

>T31707
AAGCGCTGGCTCAAGAGAGGCTCCTGCTGCCAGAAGACCCTCTGATCAGTGGCCTCCTCAACTCCCAGGC
CCTCAAGGCCTGCGTAGACACAGCCCTGGAGAACTTGTCTACTCTCAAGATGAAGGTGGCAGAGGTGCTG
GCTGGAGAAGGCCACTTGTATTCCCGAATCCCGGCACTGCTCAACACCCAGCCCATGCTACAACTGGAAT
ACACAGCCACCGACCGGCACCCCCAGGCCCTGAAGGATGTTCAGACCAAACTGCAGCAGCATGATGTGGC
GCAGGGCCAGTGGAACCCTTCCGACCCTGCGCCCAGCAGCCTGGGTGCCCTTGACCTTCTGGTGTGCAAC
TGTGCATTAGCCACCCTGGGGGATCCAGCCTTGGCCCTGGACAACATGGTAGCTGCCCTCAAGGAAGGTG
GTTTCCTGCTAGTGCACACAGTGCTCAAAGGACATGCCCTTGGGGAGACCCTGGCCTGCCTACCCTCTGA
GGTGCAGCCTGCGCCCAGCCTCCTAAGCCAGGAGGAGTGGGAGAGCCTGTTCTCGAGGAAGGCACTACAC
CTGGTGGGCCTTAAAAGGTCCTTCTACGGTACTGCGCTGTTCCTGTGCCGGCGAGCCATCCCACAGGAGA
AACCTATCTTCCTGTCTGTGGAGGATACCAGCTTCCAGTGGGTGGACTCTCTGAAGAGCACTCTGGCCAC
GTCCTCCTCCCAGCCTGTGTGGCTAACGGCCATGGACTGCCCCACCTCGGGTGTGGTGGGTTTGGTGAAT
TGTCTCCGAAAAGAGCCGGGTGGACACCGGATTCGGTGTATCCTGCTGTCCAACCTCAGC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:4196969), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 57741. Forward Primer - name:057741_F_IRAV87_a01_Fasn, sequence:AAGCGCTGGCTCAAGAGA; Reverse Primer - name:057741_R_SP6_IRAV87_a01_Fasn, sequence:TGCTGAGGTTGGACAGC. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_013691 same experiment
 EMAGE:29731 same embryo
 EMAGE:31853 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS