Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31974

Adk ( MGI:87930)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31974 EMAGE:31974 EMAGE:31974 EMAGE:31974 EMAGE:31974
euxassay_001699_01 euxassay_001699_02 euxassay_001699_03 euxassay_001699_04 euxassay_001699_05
EMAGE:31974 EMAGE:31974 EMAGE:31974 EMAGE:31974 EMAGE:31974
euxassay_001699_06 euxassay_001699_07 euxassay_001699_08 euxassay_001699_09 euxassay_001699_10
EMAGE:31974 EMAGE:31974 EMAGE:31974 EMAGE:31974 EMAGE:31974
euxassay_001699_11 euxassay_001699_12 euxassay_001699_13 euxassay_001699_14 euxassay_001699_15
EMAGE:31974 EMAGE:31974 EMAGE:31974 EMAGE:31974 EMAGE:31974
euxassay_001699_16 euxassay_001699_17 euxassay_001699_18 euxassay_001699_19 euxassay_001699_20
EMAGE:31974 EMAGE:31974 EMAGE:31974
euxassay_001699_21 euxassay_001699_22 euxassay_001699_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
foregut-midgut junction
moderate moderate
regionalmoderate expression: see section 13 14 15 16
pectoral girdle and thoracic body wall skeleton
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16 17
rectum
moderate moderate
regionalmoderate expression: see section 10 11
bladder
moderate moderate
regionalmoderate expression: see section 10 11 12 13
esophagus
moderate moderate
regionalmoderate expression: see section 11 12
pancreas
moderate moderate
regionalmoderate expression: see section 07 08 09 10 15
lower jaw molar
moderate moderate
regionalmoderate expression: see section 07 08 09 10 18 19 20
upper jaw molar
moderate moderate
regionalmoderate expression: see section 07 08 09 10 18 19 20
thymus primordium
weak weak
homogeneousweak expression: see section 10 11 12 13 14
telencephalon ventricular layer
strong strong
homogeneousstrong expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 moderate expression: see section 20 21 22 23
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 12 13 14 15 16 weak expression: see section 11
hindgut
moderate moderate
regionalmoderate expression: see section 12 13 14 15
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 21 22 23
stomach
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09
vault of skull
moderate moderate
regionalmoderate expression: see section 01 02 03
rib
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 17 18 20 21 22
thoracic vertebra
moderate moderate
regionalmoderate expression: see section 19
midgut
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15 16 17 18 19 20 weak expression: see section 09
meckel's cartilage
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 21 22 23
submandibular gland primordium
strong strong
regionalstrong expression: see section 07 08 09 10 17 18 19 20
basisphenoid bone
moderate moderate
regionalmoderate expression: see section 05
renal cortex
moderate moderate
homogeneousmoderate expression: see section 05 06 07 13 14 15 16
nucleus pulposus
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 15 16
liver lobe
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
lung
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 09 11 12 13 14 15 16 17 18 19 20 21
exoccipital bone
moderate moderate
regionalmoderate expression: see section 04 05
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1412
Entity Detected:Adk, ( MGI:87930)
Sequence:sense strand is shown

>T1412
TCCTCNAGCCTGTTGGCCTACTGGAAAACTACGGTGAGAGTGTGAAGATGGCAGCTGCGGACGAGCCCAA
GCCCAAAAAGCTCAAGGTGGAAGCGCCACAAGCGCTGAGTGAAAATGTGCTATTTGGAATGGGGAATCCT
CTTCTTGACATCTCTGCTGTAGTAGACAAAGATTTCCTTGATAAGTATTCTCTGAAACCAAATGACCAGA
TCTTGGCTGAAGACAAGCACAAGGAACTGTTTGATGAACTTGTGAAAAAATTCAAAGTTGAATATCATGC
TGGTGGCTCTACGCAGAATTCAATGAAAGTGGCTCAGTGGTTGATTCAGGAGCCACACAAAGCAGCAACA
TTCTTTGGATGCATTGGGATAGATAAGTTTGGGGAGATCCTGAAGCGTAAGGCTGCTGACGCACATGTGG
ATGCTCATTACTATGAGCAGAACGAGCAGCCAACAGGAACTTGTGCTGCGTGTATCACTGGTGGCAACAG
GTCCCTCGTTGCTAACCTTGCTGCCGCCAATTGTTACAAGAAAGAGAAGCACCTTGACCTGGAGCGGAAC
TGGGTG
Notes:The probe template was PCR amplified from IMAGE:2373226 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2373226 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_001699 same experiment
 EMAGE:29573 same embryo
 EMAGE:29572 same embryo
 EMAGE:31520 same embryo
 EMAGE:31513 same embryo
 EMAGE:29811 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS