Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31975

Pnpo pyridoxine 5'-phosphate oxidase ( MGI:2144151)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31975 EMAGE:31975 EMAGE:31975 EMAGE:31975 EMAGE:31975
euxassay_000368_21 euxassay_000368_01 euxassay_000368_02 euxassay_000368_03 euxassay_000368_04
EMAGE:31975 EMAGE:31975 EMAGE:31975 EMAGE:31975 EMAGE:31975
euxassay_000368_05 euxassay_000368_06 euxassay_000368_07 euxassay_000368_08 euxassay_000368_09
EMAGE:31975 EMAGE:31975 EMAGE:31975 EMAGE:31975 EMAGE:31975
euxassay_000368_10 euxassay_000368_11 euxassay_000368_12 euxassay_000368_13 euxassay_000368_14
EMAGE:31975 EMAGE:31975 EMAGE:31975 EMAGE:31975 EMAGE:31975
euxassay_000368_15 euxassay_000368_16 euxassay_000368_17 euxassay_000368_18 euxassay_000368_19
EMAGE:31975 EMAGE:31975 EMAGE:31975 EMAGE:31975
euxassay_000368_20 euxassay_000368_22 euxassay_000368_23 euxassay_000368_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
liver lobe
moderate moderate
homogeneousmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1482
Entity Detected:Pnpo, pyridoxine 5'-phosphate oxidase ( MGI:2144151)
Sequence:sense strand is shown

>T1482
CCTCGAGNCTGTTGGCCTACTGGAATTCTTCCTTCCCAGGCTAGACACACAGGCTGAGCAATTGGTTCCG
AACCCAGGGCCAGGCGACGCTGGGTCACGTGGCCGACTGCTTACATGACGTGCGGGCTGCTGAGCGTCAC
TGTGACGTTCAGGAGACCTGCGAAGTGGACGGGCTACCTCCGTCACCTGTGCTGTCGGGGTGCAGTCATG
GACCTGGGACCAATGCGCAAGAGTTACCGCGGGGATCGAGAGGCATTCGAGGAGACTCATCTGACCTCTC
TGGATCCCATGAAGCAGTTTGCTTCCTGGTTTGACGAGGCTGTTCAGTGTCCGGACATAGGAGAAGCCAA
TGCTATGTGTGTGGCTACCTGCACCAGAGACGGAAAACCCTCTGCCCGGATGCTGCTGCTGAAGGGCTTT
GGCAAAGACGGCTTCCGCTTCTTCACTAACTACGAGAGCCGGAAGGGAAAAGAGCTGGATTCTAATCCCT
TTGCCTCTCTTGTCTTCTACTGGGAGCCCCTGAACCGTCAGGTGCGTGTGGAAGGCCCT
Notes:The probe template was PCR amplified from IMAGE:2921815 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template usi. T7 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2921815 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_000368 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS