Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31992

C1qtnf3 C1q and tumor necrosis factor related protein 3 ( MGI:1932136)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31992 EMAGE:31992 EMAGE:31992 EMAGE:31992 EMAGE:31992
euxassay_001690_01 euxassay_001690_02 euxassay_001690_03 euxassay_001690_04 euxassay_001690_05
EMAGE:31992 EMAGE:31992 EMAGE:31992 EMAGE:31992 EMAGE:31992
euxassay_001690_06 euxassay_001690_07 euxassay_001690_08 euxassay_001690_09 euxassay_001690_10
EMAGE:31992 EMAGE:31992 EMAGE:31992 EMAGE:31992 EMAGE:31992
euxassay_001690_11 euxassay_001690_12 euxassay_001690_13 euxassay_001690_14 euxassay_001690_15
EMAGE:31992 EMAGE:31992 EMAGE:31992 EMAGE:31992 EMAGE:31992
euxassay_001690_16 euxassay_001690_17 euxassay_001690_18 euxassay_001690_19 euxassay_001690_20

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
nucleus pulposus
strong strong
regionalstrong expression: see section 04 05 07 08
upper jaw
moderate moderate
regionalmoderate expression: see section 05 06 07 08
pectoral girdle and thoracic body wall musculature
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
ventral grey horn
strong strong
regionalstrong expression: see section 06 07 08 09 10
lower jaw
moderate moderate
regionalmoderate expression: see section 05 06
axial musculature
strong strong
regionalstrong expression: see section 01 02 13 14 15 16 17 18 19 20
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1394
Entity Detected:C1qtnf3, C1q and tumor necrosis factor related protein 3 ( MGI:1932136)
Sequence:sense strand is shown

>T1394
CNCGGTACCTCCAGCCCCTGTCAAGCTTCCCTGCGAGACTCTTGTCGATTTGCCGATTTGCCGAGCCATG
CTCGGGAGGCAGCGCATCTGGTGGCACCTGCTGCCTTTGCTTTTCCTCCCATTTTGCCTGTGTCAAGATG
AATACATGGAGTCTCCACAAGCTGGAGGACTGCCCCCAGACTGCAGCAAGTGTTGCCATGGAGATTATGG
ATTTCGTGGTTACCAAGGGCCCCCTGGACCTCCAGGTCCTCCTGGCATTCCAGGAAACCATGGAAACAAT
GGGAACAATGGAGCTACTGGCCATGAAGGGGCCAAAGGTGAGAAAGGAGACAAAGGCGACCTAGGCCCTC
GAGGAGAACGGGGGCAGCATGGCCCCAAAGGAGAGAAAGGCTACCCAGGGGTGCCACCAGAACTGCAGAT
TGCATTCATGGCTTCTCTAGCAACTCACTTCAGCAATCAGAACAGTGGC
Notes:The probe template was PCR amplified from IMAGE:2372664 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2372664 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_001690 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS