Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31999

Gas6 growth arrest specific 6 ( MGI:95660)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31999 EMAGE:31999 EMAGE:31999 EMAGE:31999 EMAGE:31999
euxassay_002796_01 euxassay_002796_02 euxassay_002796_03 euxassay_002796_04 euxassay_002796_05
EMAGE:31999 EMAGE:31999 EMAGE:31999 EMAGE:31999 EMAGE:31999
euxassay_002796_06 euxassay_002796_07 euxassay_002796_08 euxassay_002796_09 euxassay_002796_10
EMAGE:31999 EMAGE:31999 EMAGE:31999 EMAGE:31999 EMAGE:31999
euxassay_002796_11 euxassay_002796_12 euxassay_002796_13 euxassay_002796_14 euxassay_002796_15
EMAGE:31999 EMAGE:31999 EMAGE:31999 EMAGE:31999 EMAGE:31999
euxassay_002796_16 euxassay_002796_17 euxassay_002796_18 euxassay_002796_19 euxassay_002796_20
EMAGE:31999 EMAGE:31999 EMAGE:31999 EMAGE:31999
euxassay_002796_21 euxassay_002796_22 euxassay_002796_23 euxassay_002796_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
thymus primordium
strong strong
homogeneousstrong expression: see section 10 11 12 13 14 15
vibrissa
moderate moderate
regionalmoderate expression: see section 06 07 08 23 24
lateral ventricle choroid plexus
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
stomach
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08
kidney calyx
strong strong
regionalstrong expression: see section 07 08 09 18 19
clavicle
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 16 17 18
rectum
strong strong
regionalstrong expression: see section 13 14
4th ventricle lateral recess
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
testis
moderate moderate
regionalmoderate expression: see section 04 05 06 07 20 21 22
bladder
moderate moderate
regionalmoderate expression: see section 12 13 14
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2124
Entity Detected:Gas6, growth arrest specific 6 ( MGI:95660)
Sequence:sense strand is shown

>T2124
TGGCCTCGAGCCAGATTCGGACGAGGGCCAGCAGGATCGCTGTGAGCAGACCTGTGTCAACTCCCCAGGC
AGCTATACCTGCCACTGTGATGGGCGAGGGGGCCTAAAACTATCCCCAGACATGGATACTTGTGAGGACA
TCTTACCATGTGTGCCCTTCAGCATGGCCAAGAGCGTGAAGTCCTTGTACCTGGGCCGCATGTTCAGCGG
GACCCCCGTGATTAGACTACGCTTCAAGAGGCTTCAGCCTACCAGGCTGCTGGCTGAATTTGACTTCCGC
ACTTTTGACCCTGAAGGAGTCCTCTTCTTCGCTGGAGGCCGTTCAGACAGCACCTGGATTGTCCTGGGCC
TAAGAGCTGGGCGGCTTGAGCTGCAGCTTCGGTACAATGGCGTTGGGCGCATCACCAGCAGCGGGCCAAC
CATCAACCACGGCATGTGGCAAACTATCTCCGTGGAAGAGCTGGAACGTAACCTTGTCATCAAGGTCAAC
AAAGATGCTGTAATGAAGATCGCGGTAGCTGGGGAGCTGTTTCAGCTGG
Notes:The probe template was PCR amplified from IMAGE:864328 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:864328 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_002796 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS