Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:32009

Frmd6 FERM domain containing 6 ( MGI:2442579)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:32009 EMAGE:32009 EMAGE:32009 EMAGE:32009 EMAGE:32009
euxassay_002791_01 euxassay_002791_02 euxassay_002791_03 euxassay_002791_04 euxassay_002791_05
EMAGE:32009 EMAGE:32009 EMAGE:32009 EMAGE:32009 EMAGE:32009
euxassay_002791_06 euxassay_002791_07 euxassay_002791_08 euxassay_002791_09 euxassay_002791_10
EMAGE:32009 EMAGE:32009 EMAGE:32009 EMAGE:32009 EMAGE:32009
euxassay_002791_11 euxassay_002791_12 euxassay_002791_13 euxassay_002791_14 euxassay_002791_15
EMAGE:32009 EMAGE:32009 EMAGE:32009 EMAGE:32009 EMAGE:32009
euxassay_002791_16 euxassay_002791_17 euxassay_002791_18 euxassay_002791_19 euxassay_002791_20
EMAGE:32009 EMAGE:32009 EMAGE:32009 EMAGE:32009
euxassay_002791_21 euxassay_002791_22 euxassay_002791_23 euxassay_002791_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 06 07 08 18 19 20 weak expression: see section 09 10
medulla oblongata basal plate
moderate moderate
regionalmoderate expression: see section 08 09 15 16
thymus primordium
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15
vibrissa
strong strong
regionalstrong expression: see section 06 07 08 09 22 23
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2254
Entity Detected:Frmd6, FERM domain containing 6 ( MGI:2442579)
Sequence:sense strand is shown

>T2254
GGNCCTCNAGGCCAAGATTCGGATCCTTGACAGACGATATGTCGAAAACCAAAGACTTCCACCGATCGCC
ATAGCCTGAGCCTTGACGACATCAGACTGTACCAGAAAGACTTCCTGCGCATCGCGGGCCTGTGTCAGGA
CACTGCTCAGAGCTACACGTTTGGGTGTGGCCATGAACTGGATGAGAGCGGTCTCTACTGCAACAGCTGC
CTGGCTCAGCAGTGTGTCAACATACAGGACGCATTCCCAGTGAAAAGAGCCAGCAAGTACTTTTCTCTGG
ACCTTACTCACGACGAAGTCCCAGAGTTCGTCGTCTGAGTCGCCCCTGCGGGCAGCCCTGCGGGCAGCCG
CTGTCTGCTGGAGGCTGTGGAGTCTGAGGGTCTTTACACATTATTTGTGCCATAACTTTTTCACCCCAAA
CTTAGCTTTTTCTTTATAGTATTCGAGATGGAAACAAAAGCCTTGGGACAGTTGCACTTTAAGTATTATG
CAGAGGTAAAAGAAACAGAGAATGTAAGAGGAAGACAAGTGCCCAGATTGTCTATTGCCCCTTTGGAAGG
AAGTGTGCT
Notes:The probe template was PCR amplified from IMAGE:1065217 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1065217 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_002791 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS