Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:32032

Zcchc7 zinc finger, CCHC domain containing 7 ( MGI:2442912)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:32032 EMAGE:32032 EMAGE:32032 EMAGE:32032 EMAGE:32032
euxassay_009156_01 euxassay_009156_02 euxassay_009156_03 euxassay_009156_04 euxassay_009156_05
EMAGE:32032 EMAGE:32032 EMAGE:32032 EMAGE:32032 EMAGE:32032
euxassay_009156_06 euxassay_009156_07 euxassay_009156_08 euxassay_009156_09 euxassay_009156_10
EMAGE:32032 EMAGE:32032 EMAGE:32032 EMAGE:32032 EMAGE:32032
euxassay_009156_11 euxassay_009156_12 euxassay_009156_13 euxassay_009156_14 euxassay_009156_15
EMAGE:32032 EMAGE:32032 EMAGE:32032 EMAGE:32032 EMAGE:32032
euxassay_009156_16 euxassay_009156_17 euxassay_009156_18 euxassay_009156_19 euxassay_009156_20
EMAGE:32032 EMAGE:32032 EMAGE:32032 EMAGE:32032
euxassay_009156_21 euxassay_009156_22 euxassay_009156_23 euxassay_009156_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 05 15 16
rest of cerebellum mantle layer
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 12 13 14
pons ventricular layer
strong strong
regionalstrong expression: see section 05 06 07 10 11 12
spinal cord
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14
brain
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 05 16
anterior naris
moderate moderate
regionalmoderate expression: see section 14 17
rest of cerebellum ventricular layer
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12
pons mantle layer
strong strong
regionalstrong expression: see section 04 05 06 07 10 11 12 13 14
retina
moderate moderate
regionalmoderate expression: see section 01 02 03 04 22 23 24
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 weak expression: see section 15
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 03 04 17 18 19
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 06 15
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 16 17 18 19 20
lens
strong strong
regionalstrong expression: see section 01 02 24
vibrissa
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 20 21 22 23 24
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16 17 18 19
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2428
Entity Detected:Zcchc7, zinc finger, CCHC domain containing 7 ( MGI:2442912)
Sequence:sense strand is shown

>T2428
TGGCCTCGAGCCAGATTCGGCACGAGGCAGAAGCCTTCTAAGTCCCTCCACCATGCATCCCATTACCACA
GGCTGAGAGAAGAGCGGCTTCTCAGGGAGAGCAAGCGGAGCAAGCCAAAGAAAAGGAAGAGTACAGAGGA
CGGCAGCCATGATGATTTGTTTCTTATTAAGCAAAAGAAGAAGAAGCCTAAGCCGAGTGGTCTCTGACCT
GGTCTCCGCGCTTCAGTGTCCTGGAAGTGCTTAAGTACCTGTTAATGAGACGCTGGGATTGAATGCTGAG
TTCCGGCCATGCCTGGAGTGGCTGTACAGAGACCACAAAGAGTTCAGGTCTGTGTCCACAGGCTGTTCCT
AGGTAGGAAGGCAAACTTGAGGTAGAAAATTGTCTTTTCATGAAAACCTTTTTAAATGCTTTGGAAAAAT
TACAAGCTCATCAGATGATTTTATCTCCAATGTTTGAGGACTTAAAAGCTCATTGGAAGAAAGTTTATTG
TTAAGAAAAGTCATCACTTTTTTAGCTTTTTTTTTAAGAACACTGGAAAAATCAATGAAAATCCAAGCCC
Notes:The probe template was PCR amplified from IMAGE:1243648 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1243648 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_009156 same experiment
 EMAGE:31439 same embryo
 EMAGE:30990 same embryo
 EMAGE:32036 same embryo
 EMAGE:32038 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS