Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:32055

Zfp2 zinc finger protein 2 ( MGI:99167)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:32055 EMAGE:32055 EMAGE:32055 EMAGE:32055 EMAGE:32055
euxassay_002774_01 euxassay_002774_02 euxassay_002774_03 euxassay_002774_04 euxassay_002774_05
EMAGE:32055 EMAGE:32055 EMAGE:32055 EMAGE:32055 EMAGE:32055
euxassay_002774_06 euxassay_002774_07 euxassay_002774_08 euxassay_002774_09 euxassay_002774_10
EMAGE:32055 EMAGE:32055 EMAGE:32055 EMAGE:32055 EMAGE:32055
euxassay_002774_11 euxassay_002774_12 euxassay_002774_13 euxassay_002774_14 euxassay_002774_15
EMAGE:32055 EMAGE:32055 EMAGE:32055 EMAGE:32055 EMAGE:32055
euxassay_002774_16 euxassay_002774_17 euxassay_002774_18 euxassay_002774_19 euxassay_002774_20
EMAGE:32055 EMAGE:32055 EMAGE:32055
euxassay_002774_21 euxassay_002774_22 euxassay_002774_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 17 18 19
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 03 20 21
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 17 18 19 20 21 22
cervical ganglion
moderate moderate
regionalmoderate expression: see section 09 17
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 06 07 08 17 18 19
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 10 17
spinal cord
moderate moderate
homogeneousmoderate expression: see section 10 11 12 13 14 15 16 17
brain
moderate moderate
homogeneousmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 07 08 18
thoracic ganglion
moderate moderate
regionalmoderate expression: see section 13 14 15
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T174
Entity Detected:Zfp2, zinc finger protein 2 ( MGI:99167)
Sequence:sense strand is shown

>T174
TGAATGTGGAAAGGCATTCAGCCAAAGCGCCTATCTCATTGAACATCAAAGGATTCATACTGGTGAAAAA
CCCTATGAATGTGATCAGTGTGGGAAAGCTTTCATAAAGAACTCATCCCTTATAGTGCACCAGAGGATAC
ATACAGGAGAGAAACCCTATCAGTGCAATGAATGTGGAAAGTCCTTCAGTAGGAGTACAAACCTTACAAG
ACATCAGAGGACTCATACATGAGAAATGCTCTCGTCAACTCCTTCATTTTGTTTAACCTTTTGATACTAA
TCAGATGTCACACTGATGTAGATACTTAGTAAATATAACTAATGTGGTAACTTTTTAGTTGAAGAACAAT
ATAGCATAGCAGATAATAAAATCATAGAGAGTAACCATGTGAAAGTGGAGAACCCTTGATTCAGATTTGA
GTAGCTATGACATAAATAATGAAGCTGTATTTGGTCACACTGGGAAATCTGATTTGGGCATCACAA
Notes:The probe template was PCR amplified from IMAGE:2646150 using vector specific primers. Forward Primer - name:RZ. T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template usi. T7 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2646150 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_002774 same experiment
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS