Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:32063

2210020M01Rik ( MGI:1913778)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:32063 EMAGE:32063 EMAGE:32063 EMAGE:32063 EMAGE:32063
euxassay_010380_01 euxassay_010380_02 euxassay_010380_03 euxassay_010380_04 euxassay_010380_05
EMAGE:32063 EMAGE:32063 EMAGE:32063 EMAGE:32063 EMAGE:32063
euxassay_010380_06 euxassay_010380_07 euxassay_010380_08 euxassay_010380_09 euxassay_010380_10
EMAGE:32063 EMAGE:32063 EMAGE:32063 EMAGE:32063 EMAGE:32063
euxassay_010380_11 euxassay_010380_12 euxassay_010380_13 euxassay_010380_14 euxassay_010380_15
EMAGE:32063 EMAGE:32063 EMAGE:32063 EMAGE:32063 EMAGE:32063
euxassay_010380_16 euxassay_010380_17 euxassay_010380_18 euxassay_010380_19 euxassay_010380_20
EMAGE:32063 EMAGE:32063 EMAGE:32063
euxassay_010380_21 euxassay_010380_22 euxassay_010380_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
choroid invagination
weak weak
regionalweak expression: see section 06 07 08 09 10 14 15 16 17 18 19
metencephalon part of 4th ventricle choroid plexus
weak weak
regionalweak expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
clavicle
moderate moderate
regionalmoderate expression: see section 08 09 16
diencephalon roof plate
weak weak
regionalweak expression: see section 12 13
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30525
Entity Detected:2210020M01Rik, ( MGI:1913778)
Sequence:sense strand is shown

>T30525
GCCCACAAAACCCAGATGAGGGACAACAGCGAGCTGCCTGGAGAGAAGCTGGACAAGAGCCTTCCAGGAC
TGTAACCCAGGCTATTACCATGGCCACTTTACTCTTCTAGACAAAGGTTACCTGGCCCCAGTTGTGGCAT
TTCCCAGGTGACAGGACAGACATCTGGAGTCTTATCAAGGAAACAAGTGTTGCCCCATCTGCCGGGGACA
CGGGGCTCTGTTGGAGCTGATGGTTTCACACTCAGACCACCACCTGGGGCATCTGCTAAGCTGACCCTTT
TAAGGGTCCCGCACTTCAATAGGGACCAGCTCATGCTTGTCAGGAGCTGGCTCCTGAGGCTCTGCTGACC
TATGCCAAAGAGAAGTAAGCTAGCGAGGGACTCTGTGCACTTTATCAGACTCCAGGCCTCCTGCTGAGGG
GGAGGAACA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:3419127), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 60558. Forward Primer - name:060558_F_IRAV110_e02_2210020M01Rik, sequence:GCCCACAAAACCCAGATG; Reverse Primer - name:060558_R_SP6_IRAV110_e02_2210020M01Rik, sequence:ATGTTCCTCCCCCTCAG. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_010380 same experiment
 EMAGE:30669 same embryo
 EMAGE:32071 same embryo
 EMAGE:30691 same embryo
 EMAGE:30552 same embryo
 EMAGE:30688 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS