Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:32169

Socs4 ( MGI:1914546)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:32169 EMAGE:32169 EMAGE:32169 EMAGE:32169 EMAGE:32169
euxassay_012190_01 euxassay_012190_02 euxassay_012190_03 euxassay_012190_04 euxassay_012190_05
EMAGE:32169 EMAGE:32169 EMAGE:32169 EMAGE:32169 EMAGE:32169
euxassay_012190_06 euxassay_012190_07 euxassay_012190_08 euxassay_012190_09 euxassay_012190_10
EMAGE:32169 EMAGE:32169 EMAGE:32169 EMAGE:32169 EMAGE:32169
euxassay_012190_11 euxassay_012190_12 euxassay_012190_13 euxassay_012190_14 euxassay_012190_15
EMAGE:32169 EMAGE:32169 EMAGE:32169 EMAGE:32169 EMAGE:32169
euxassay_012190_16 euxassay_012190_17 euxassay_012190_18 euxassay_012190_19 euxassay_012190_20
EMAGE:32169 EMAGE:32169 EMAGE:32169
euxassay_012190_21 euxassay_012190_22 euxassay_012190_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
medulla oblongata basal plate ventricular layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17
pons ventricular layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 weak expression: see section 06
rest of cerebellum ventricular layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 weak expression: see section 06
retina
moderate moderate
regionalmoderate expression: see section 01 02 03 weak expression: see section 22 23
spinal cord ventricular layer
moderate moderate
regionalmoderate expression: see section 10 11 weak expression: see section 09
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 07 08 12 13
thymus primordium
moderate moderate
regionalmoderate expression: see section 11 12 13 14 weak expression: see section 10
medulla oblongata alar plate ventricular layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 07 08 16 17 18 19 20 weak expression: see section 21
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 09 10 11 13 14 15 16 17 18 19 20 21 22 23
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 16 17
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 10 11 13 14 15 weak expression: see section 08 09
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 11 12 13
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T37069
Entity Detected:Socs4, ( MGI:1914546)
Sequence:sense strand is shown

>T37069
CCTCGCTCAGATTTAGCCTTTAGGTGGCATTTTATTAAACGACACACTGTTCCTATGAGTCCCAACTCAG
ATGAATGGGTGAGTGCAGACCTGTCTGAGAGGAAACTGAGAGATGCTCAGCTGAAACGAAGAAACACAGA
AGATGACATACCCTGTTTCTCACATACCAATGGCCAGCCTTGTGTCATAACTGCCAACAGTGCTTCGTGT
ACAGGTGGTCACATAACTGGTTCTATGATGAACTTGGTCACAAACAACAGCATAGAAGACAGTGACATGG
ATTCAGAGGATGAAATTATAACGCTGTGCACAAGCTCCAGAAAAAGGAATAAGCCCAGGTGGGAAATGGA
AGAGGAGATCCTGCAGTTGGAGGCACCTCCTAAGTTCCACACCCAGATCGACTACGTCCACTGCCTTGTT
CCAGACCTCCTTCAGATCAGTAACAATCCGTGCTACTGGGGTGTCATGGACAAATATGCAGCCGAAGCTC
TGCTGGAAGGAAAGCCAGAGGGCACCTTTTTACTTCGAGATTCAGCGCAGGAAGATTATTTATTCTCTGT
TAGTTTTAGACGCTACAGTCGTTCTCTTCATGCTAGAATTGAGCAGTGGAATCATAACTTTAGCTTTGAT
GCCCATGATCCTTGTGTCTTCCATTCTCCTGATATTACTGGGCTCCTGGAACACTATAAGGACCCCAGTG
CCTGTATGTTCTTTGAGCCGCTCTTGTCCACTCCCTTAATCCGGACGTTCCCCTTTTCCTTGCAGCATAT
TTGCAGAACGGTTATTTGTAATTGTACGACTTACGATGGCATCGATGCCCTTCCCATTCCTTCGCCTATG
AAAT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 101109. Forward Primer - name:101109_F_cDNA_Socs4, sequence:CCTCGCTCAGATTTAGCCTTTA; Reverse Primer - name:101109_N_SP6_cDNA_Socs4, sequence:ATTTCATAGGCGAAGGAATG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_012190 same experiment
 EMAGE:30746 same embryo
 EMAGE:32171 same embryo
 EMAGE:32172 same embryo
 EMAGE:31469 same embryo
 EMAGE:30763 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS