Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:32187

Spg20 ( MGI:2139806)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:32187 EMAGE:32187 EMAGE:32187 EMAGE:32187 EMAGE:32187
euxassay_002395_01 euxassay_002395_02 euxassay_002395_03 euxassay_002395_04 euxassay_002395_05
EMAGE:32187 EMAGE:32187 EMAGE:32187 EMAGE:32187 EMAGE:32187
euxassay_002395_06 euxassay_002395_07 euxassay_002395_08 euxassay_002395_09 euxassay_002395_10
EMAGE:32187 EMAGE:32187 EMAGE:32187 EMAGE:32187 EMAGE:32187
euxassay_002395_11 euxassay_002395_12 euxassay_002395_13 euxassay_002395_14 euxassay_002395_15
EMAGE:32187 EMAGE:32187 EMAGE:32187 EMAGE:32187 EMAGE:32187
euxassay_002395_16 euxassay_002395_17 euxassay_002395_18 euxassay_002395_19 euxassay_002395_20
EMAGE:32187 EMAGE:32187 EMAGE:32187
euxassay_002395_21 euxassay_002395_22 euxassay_002395_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 06 07 08 13 14 15
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 19 20 weak expression: see section 17 18 21 22
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 11 12 14 15 16 weak expression: see section 10
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T3431
Entity Detected:Spg20, ( MGI:2139806)
Sequence:sense strand is shown

>T3431
GCCAACTGGAATAGAGAAGAAGATGAATTCCAAATCCCTGGGAGATCAAGTCACCCCTCTGAACCACCGA
AGGAAGCTTCTGGCACTGATGTCAGGCAGTCAAGTTCTTCAGGTTCCTCAATAGACCAAGGCAGCAAGGA
TGCCCGCCATAAAGGAAAGCGTGGGAAAAAGACCAAAGATTCAAGTGAAGAAGTTAATCTGAGCCAGATT
GTGCCCTGTGAGCCGAGTTCAGAAGAAAAATCGAAAGAATTGCCTGAATGGAGCGAGAAAGTGGCCCACA
ACATCCTGTCAGGTGCTTCCTGGGTGAGCTGGGGTTTAGTCAAAGGTGCTGAATTTACTGGCAAAGCAAT
TCAGAAAGGTGCTTCTAAACTCAGAGAGCGCATTCAGCCGGAGGAAAAGCCAGTGGAGGTGAGCCCAGCT
GTCACCAGGGGTCTCTACATAGCGAAGCAGGCAACCGGAGGAGCAGCCAAAGTCAGCCAGCTCCTGGTTG
ACGGCGTCTGCACAGTAGCGAATTGTGTTGGTA
Notes:The probe template was PCR amplified from IMAGE:3025916 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:3025916 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_002395 same experiment
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS