Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:32214

Slc25a1 ( MGI:1345283)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:32214 EMAGE:32214 EMAGE:32214 EMAGE:32214 EMAGE:32214
euxassay_007829_01 euxassay_007829_02 euxassay_007829_03 euxassay_007829_04 euxassay_007829_05
EMAGE:32214 EMAGE:32214 EMAGE:32214 EMAGE:32214 EMAGE:32214
euxassay_007829_06 euxassay_007829_07 euxassay_007829_08 euxassay_007829_09 euxassay_007829_10
EMAGE:32214 EMAGE:32214 EMAGE:32214 EMAGE:32214 EMAGE:32214
euxassay_007829_11 euxassay_007829_12 euxassay_007829_13 euxassay_007829_14 euxassay_007829_15
EMAGE:32214 EMAGE:32214 EMAGE:32214 EMAGE:32214 EMAGE:32214
euxassay_007829_16 euxassay_007829_17 euxassay_007829_18 euxassay_007829_19 euxassay_007829_20
EMAGE:32214 EMAGE:32214 EMAGE:32214
euxassay_007829_21 euxassay_007829_22 euxassay_007829_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 10 11 13 14 15 17 18
submandibular gland primordium
weak weak
regionalweak expression: see section 07 08 09 10 16 17 18 19
cervical ganglion
weak weak
regionalweak expression: see section 10 18
liver left lobe
strong strong
regionalstrong expression: see section 01 02 moderate expression: see section 03 04 05 06 07 08 09 10 11
ventral grey horn
moderate moderate
regionalmoderate expression: see section 11 12 13 15 17 weak expression: see section 14 16
liver right lobe
moderate moderate
regionalmoderate expression: see section 12 13 14 15 16 17 23 weak expression: see section 18 19 20 21 22
cervico-thoracic ganglion
weak weak
regionalweak expression: see section 11 17
clavicle
weak weak
regionalweak expression: see section 10 11 18
trigeminal v nerve
moderate moderate
regionalmoderate expression: see section 09 15 16 weak expression: see section 08
thoracic ganglion
weak weak
regionalweak expression: see section 12 13
pons mantle layer
moderate moderate
regionalmoderate expression: see section 08 17 18
midgut loop
weak weak
regionalweak expression: see section 07 08 09 10 11 12 13 14 15 16
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T3144
Entity Detected:Slc25a1, ( MGI:1345283)
Sequence:sense strand is shown

>T3144
TGGCCTCGAGCNAGATTCGGACGAGGGGCCATCGTATTCATCATCTACGATGAAGTGGTGAAGCTGCTCA
ATAAAGTGTGGAAGACAGACTAACCCTGGAGGATGCAGTGGGGTATCCCAGCTCCTCCATTCCAGACCCC
CCGCCACCTACTCTGATGATTCCAGTGCAGTAGTGCCAAAAGGCCCCTTCCTTTGTCCCTCAAGTTCTGT
GGCCTGGTGTGTCCCATAGTTCTGTATATCCCATGTGGTCTGTGTGTGTGTAACACTACCATTGTATCTG
TGTCCAGCCTGGCCATGGCTGGGTGTCTCTTTGGCCTGTGAATATGTGCTCACTTATCCATGTGCTTGCT
TGTGAGCCACATGCCTGTTTCGTGTTCTCTGTCATGTGACCCTGTGCCCCACTTCCTGGGGTGCCTATGT
GCCCTGGTTCATGGCCTTGGAGCCATGGTCAGGTCACAGTCCGGTGCCTTCCACCCCCTATGGCAAGGGC
GCCCTGCCTTGGCCTACCACAGCTGCCTCCAGGCTTAGACCTGGCTTCACCGCA
Notes:The probe template was PCR amplified from IMAGE:1547830 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1547830 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_007829 same experiment
 EMAGE:29936 same embryo
 EMAGE:29839 same embryo
 EMAGE:29938 same embryo
 EMAGE:32191 same embryo
 EMAGE:29943 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS