Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:32226

Olfr282 ( MGI:3030116)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:32226 EMAGE:32226 EMAGE:32226 EMAGE:32226 EMAGE:32226
euxassay_013014_01 euxassay_013014_02 euxassay_013014_03 euxassay_013014_04 euxassay_013014_05
EMAGE:32226 EMAGE:32226 EMAGE:32226 EMAGE:32226 EMAGE:32226
euxassay_013014_06 euxassay_013014_07 euxassay_013014_08 euxassay_013014_09 euxassay_013014_10
EMAGE:32226 EMAGE:32226 EMAGE:32226 EMAGE:32226 EMAGE:32226
euxassay_013014_11 euxassay_013014_12 euxassay_013014_13 euxassay_013014_14 euxassay_013014_15
EMAGE:32226 EMAGE:32226 EMAGE:32226 EMAGE:32226 EMAGE:32226
euxassay_013014_16 euxassay_013014_17 euxassay_013014_18 euxassay_013014_19 euxassay_013014_20
EMAGE:32226 EMAGE:32226 EMAGE:32226 EMAGE:32226
euxassay_013014_21 euxassay_013014_22 euxassay_013014_23 euxassay_013014_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
nasal cavity olfactory epithelium
weak weak
single cellweak expression: see section 15 16
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T39117
Entity Detected:Olfr282, ( MGI:3030116)
Sequence:sense strand is shown

>T39117
CTGCTCTCTGTCATGGCTTATGACCGCTATGCTGCCATCTGCCATCCCCTGCTCTACGGCCAGGTGATGA
GAAATGAGTTGTGTGTAAGGCTTGTGGTCATCTCATGGGGCGTGGCCTCTCTCAACGCAACCATCATCGT
GCTCTTGGCTGTCAACCTGGACTTCTGTGGGGCTCAAACCATTCACCACTACACCTGTGAGCTGCCTG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 152342. Forward Primer - name:152342_F_cDNA_Olfr282, sequence:CTGCTCTCTGTCATGGCTTATG; Reverse Primer - name:152342_N_SP6_cDNA_Olfr282, sequence:CAGGCAGCTCACAGGTGTAG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_013014 same experiment
 EMAGE:32230 same embryo
 EMAGE:30789 same embryo
 EMAGE:32233 same embryo
 EMAGE:32225 same embryo
 EMAGE:32236 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS