EMAGE mouse gene expression spatial database

EMAGE:3555

Tdgf1 teratocarcinoma-derived growth factor 1 ( MGI:98658)
TS13 (8.5 dpc)
in situ hybridisation

Data Images


Fig2C.Copyright: Reprinted with permission from Elsevier from [doi:10.1016/S0925-4773(99)00235-X] Mech Dev 90: 133-42, Minchiotti G; Parisi S; Liguori G; Signore M; Lania G; Adamson ED; Lago CT; Persico MG, Membrane-anchorage of Cripto protein by glycosylphosphatidylinositol and its distribution during early mouse development. Copyright 2000.	Fig2F.Copyright: Reprinted with permission from Elsevier from [doi:10.1016/S0925-4773(99)00235-X] Mech Dev 90: 133-42, Minchiotti G; Parisi S; Liguori G; Signore M; Lania G; Adamson ED; Lago CT; Persico MG, Membrane-anchorage of Cripto protein by glycosylphosphatidylinositol and its distribution during early mouse development. Copyright 2000.

Expression pattern clarity:
Find spatially similar expression patterns:

Notes:

Fig 2C shows in situ hybridisation detection of the transcript. Fig 2F shows an adjacent section (showing morphology and detection of the protein).

Expression Pattern Description

Spatial Annotation:

Annotation colour key:

3D mapping

spatial mapping

View mapped 3D expression image

Download individual expression domains:

Download all expression domains:

Find spatially similar expression patterns:

Morphological match to the template:

Text Annotation:

Structure

Level

Pattern

Notes

bulbus cordis caudal half

detected

bulbus cordis rostral half

detected

Annotation Validation:

EMAGE Editor

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	MGI:1335873
Entity Detected:	Tdgf1, teratocarcinoma-derived growth factor 1 ( MGI:98658)
Sequence:	sense strand is shown >MGI:1335873 GGCCAGCTCCACTGTCTTCCTCAGACCTTTCTACCTGGCTGTGATGGTCACGTGATGGACCAGGACCTCA AAGCATCCAGGACTCCGTGTCAAACGCCGTCTGTGACGACCACTTTTATGCTAGCTGGCGCCTGCCTTTT TCTAGATATGAAAGTTTAGGTGTCATGTGAATTCCATGCCAGTGCCATAGCAAAGATGTCATTCATCTTG ATGCTCACAGTGAATCCCTAATGTTACCCCTCAAAACACTAACTAGGCCTTTCCTCTGCACGGTCCCTCC TCTTTCTGGAAAACTATGGCGTGTGT
	nt 582 - nt 887 of M87321.1
Notes:	The Tdgf1 (Cripto) probe used in this study by Minchiotti et al., 2000 [PMID:10640699] is indicated as that originally described by Dono et al., 1993 [PMID:7916676] i.e. "from nucleotide 357 to 662" of the cripto cDNA (with numbering referring to Fig 1A therein). Editors Note: M87321.1 corresponds to the sequence submitted to GenBank by Dono et al. Nucleotide numbering in the paper is relative to the start codon however numbering in GenBank is from the 5' end of the transcript. The co-ordinates with respect to M87321.1 refer to the GenBank numbering.
Chemistry:	RNA
Strand:	antisense
Label:	S35

Specimen

Procedures

Fixation:	4% paraformaldehyde
Staining procedure:	autoradiography

General Information

Authors:	Minchiotti G; Parisi S; Liguori G; Signore M; Lania G; Adamson ED; Lago CT; Persico MG, 2000 [PMID:10640699] . Indexed by GXD, Spatially mapped by EMAGE.
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	non-screen
References:	[ doi:10.1016/S0925-4773(99)00235-X] [ PMID:10640699] Minchiotti G, Parisi S, Liguori G, Signore M, Lania G, Adamson ED, Lago CT, Persico MG 2000 Membrane-anchorage of Cripto protein by glycosylphosphatidylinositol and its distribution during early mouse development. Mech Dev (90):133-42
	[ PMID:7916676] Dono R, Scalera L, Pacifico F, Acampora D, Persico MG, Simeone A 1993 The murine cripto gene: expression during mesoderm induction and early heart morphogenesis. Development (118):1157-68
Links:	MGI:2388003 same experiment
	Ensembl same gene
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source