Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:3555

Tdgf1 teratocarcinoma-derived growth factor 1 ( MGI:98658)
TS13 (8.5 dpc)
in situ hybridisation

Data Images
EMAGE:3555 EMAGE:3555
Fig2C.Copyright: Reprinted with permission from Elsevier from [doi:10.1016/S0925-4773(99)00235-X] Mech Dev 90: 133-42, Minchiotti G; Parisi S; Liguori G; Signore M; Lania G; Adamson ED; Lago CT; Persico MG, Membrane-anchorage of Cripto protein by glycosylphosphatidylinositol and its distribution during early mouse development. Copyright 2000. Fig2F.Copyright: Reprinted with permission from Elsevier from [doi:10.1016/S0925-4773(99)00235-X] Mech Dev 90: 133-42, Minchiotti G; Parisi S; Liguori G; Signore M; Lania G; Adamson ED; Lago CT; Persico MG, Membrane-anchorage of Cripto protein by glycosylphosphatidylinositol and its distribution during early mouse development. Copyright 2000.

Expression pattern clarity: three stars
Find spatially similar expression patterns: Find spatially similar patterns
Notes:
Fig 2C shows in situ hybridisation detection of the transcript. Fig 2F shows an adjacent section (showing morphology and detection of the protein).
Expression Pattern Description
Spatial Annotation:
EMAGE:3555EMAGE:3555Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
3D mappingspatial mapping

View mapped 3D expression image EMAGE genex expression entry
Download individual expression domains:
3555_voxel_strong_3D_1.wlz
3555_voxel_notDetected_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:3555_all_domains.zip
Find spatially similar expression patterns: EMAGE spatially similar patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
bulbus cordis caudal half
detected detected
bulbus cordis rostral half
detected detected
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:1335873
Entity Detected:Tdgf1, teratocarcinoma-derived growth factor 1 ( MGI:98658)
Sequence:sense strand is shown

>MGI:1335873
GGCCAGCTCCACTGTCTTCCTCAGACCTTTCTACCTGGCTGTGATGGTCACGTGATGGACCAGGACCTCA
AAGCATCCAGGACTCCGTGTCAAACGCCGTCTGTGACGACCACTTTTATGCTAGCTGGCGCCTGCCTTTT
TCTAGATATGAAAGTTTAGGTGTCATGTGAATTCCATGCCAGTGCCATAGCAAAGATGTCATTCATCTTG
ATGCTCACAGTGAATCCCTAATGTTACCCCTCAAAACACTAACTAGGCCTTTCCTCTGCACGGTCCCTCC
TCTTTCTGGAAAACTATGGCGTGTGT
nt 582 - nt 887 of M87321.1
Notes:The Tdgf1 (Cripto) probe used in this study by Minchiotti et al., 2000 [PMID:10640699] is indicated as that originally described by Dono et al., 1993 [PMID:7916676] i.e. "from nucleotide 357 to 662" of the cripto cDNA (with numbering referring to Fig 1A therein). Editors Note: M87321.1 corresponds to the sequence submitted to GenBank by Dono et al. Nucleotide numbering in the paper is relative to the start codon however numbering in GenBank is from the 5' end of the transcript. The co-ordinates with respect to M87321.1 refer to the GenBank numbering.
Chemistry:RNA
Strand:antisense
Label:S35
Specimen
Organism:mouse
Age:8.5 dpc
Theiler Stage:TS13
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:4% paraformaldehyde
Staining procedure:autoradiography
General Information
Authors:Minchiotti G; Parisi S; Liguori G; Signore M; Lania G; Adamson ED; Lago CT; Persico MG, 2000 [PMID:10640699] . Indexed by GXD, Spatially mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1016/S0925-4773(99)00235-X] [ PMID:10640699] Minchiotti G, Parisi S, Liguori G, Signore M, Lania G, Adamson ED, Lago CT, Persico MG 2000 Membrane-anchorage of Cripto protein by glycosylphosphatidylinositol and its distribution during early mouse development. Mech Dev (90):133-42
 [ PMID:7916676] Dono R, Scalera L, Pacifico F, Acampora D, Persico MG, Simeone A 1993 The murine cripto gene: expression during mesoderm induction and early heart morphogenesis. Development (118):1157-68
Links:MGI:2388003 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI