Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:4580

Fgfr2 fibroblast growth factor receptor 2 ( MGI:95523)
TS16 (9.5 dpc)
in situ hybridisation

Data Images
EMAGE:4580 EMAGE:4580
Fig2G. Copyright: This image is from [doi:10.1002/dvdy.10362] Wright TJ, Hatch EP, Karabagli H, Karabagli P, Schoenwolf GC, Mansour SL. "Expression of mouse fibroblast growth factor and fibroblast growth factor receptor genes during early inner ear development." Dev Dyn 2003 Oct;228(2):267-72. Reprinted with permission of Wiley-Liss Inc. [PMID:14517998] . Fig2H. Copyright: This image is from [doi:10.1002/dvdy.10362] Wright TJ, Hatch EP, Karabagli H, Karabagli P, Schoenwolf GC, Mansour SL. "Expression of mouse fibroblast growth factor and fibroblast growth factor receptor genes during early inner ear development." Dev Dyn 2003 Oct;228(2):267-72. Reprinted with permission of Wiley-Liss Inc. [PMID:14517998] .

Expression pattern clarity: three stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
Image annotations: In G the approximate section plane of H is shown with the line. In H, ov = otic vesicle, nt = neural tube, ba - branchial arch.
Expression Pattern Description
Spatial Annotation:
EMAGE:4580Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
4580_wholemount_moderate_3D_1.wlz
4580_wholemount_weak_3D_1.wlz
4580_wholemount_notDetected_3D_1.wlz
4580_wholemount_strong_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:4580_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
future brain
detected detected
regionalExpression is in the neurectoderm medial to the preplacodal otic ectoderm at three somites.
branchial arch
detected detected
regionalExpressed in mesenchyme.
forelimb bud
detected detected
hindlimb bud
detected detected
nephric cord
detected detected
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:1276026
Entity Detected:Fgfr2, fibroblast growth factor receptor 2 ( MGI:95523)
Sequence:sense strand is shown

>MGI:1276026
TGTAACTTTTGAGGATGCTGGGGAATATACGTGCTTGGCGGGTAATTCTATCGGGATATCCTTTCACTCT
GCATGGTTGACAGTTCTGCCAGCGCCTGTGAGAGAGAAGGAGATCACGGCTTCCCCAGATTATCTGGAG
nt 1599 - nt 1737 of NM_010207.1
Notes:The Fgfr2 probe used in this study by Wright et al., 2003 [PMID:14517998] was generated from "accession no. NM010207, bp1599-1737". Editor's note: This probe is specific to transcript variant 1, exon IIIc, of Fgfr2 (Fgfr2IgIIIc). In 2003 when this paper was published there was only one version of NM_010207 (NM_010207.1)
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:CD-1
Age:9.5 dpc
Theiler Stage:TS16
Mutations:none (wild-type)
Preparation:wholemount
Procedures
General Information
Authors:Wright TJ; Hatch EP; Karabagli H; Karabagli P; Schoenwolf GC; Mansour SL, 2003 [PMID:14517998] . Indexed by GXD, Spatially mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1002/dvdy.10362] [ PMID:14517998] Wright TJ, Hatch EP, Karabagli H, Karabagli P, Schoenwolf GC, Mansour SL 2003 Expression of mouse fibroblast growth factor and fibroblast growth factor receptor genes during early inner ear development. Dev Dyn (228):267-72
Links:MGI:3589559 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI