Type: | in situ hybridisation probe |
Identifier: | MGI:1335873 |
Entity Detected: | Tdgf1, teratocarcinoma-derived growth factor 1 ( MGI:98658) |
Sequence: | sense strand is shown
>MGI:1335873
GGCCAGCTCCACTGTCTTCCTCAGACCTTTCTACCTGGCTGTGATGGTCACGTGATGGACCAGGACCTCA
AAGCATCCAGGACTCCGTGTCAAACGCCGTCTGTGACGACCACTTTTATGCTAGCTGGCGCCTGCCTTTT
TCTAGATATGAAAGTTTAGGTGTCATGTGAATTCCATGCCAGTGCCATAGCAAAGATGTCATTCATCTTG
ATGCTCACAGTGAATCCCTAATGTTACCCCTCAAAACACTAACTAGGCCTTTCCTCTGCACGGTCCCTCC
TCTTTCTGGAAAACTATGGCGTGTGT
|
| nt 582 - nt 887 of M87321.1 |
Notes: | The Tdgf1 (cripto) probe used in this study by Dono et al., 1993 [PMID:7916676] is described by the authors as "from nucleotide 357 to 662" of the cripto cDNA (with numbering referring to Fig 1A therein).
Editors Note: M87321.1 corresponds to the sequence submitted to GenBank by Dono et al. Nucleotide numbering in the paper is relative to the start codon however numbering in GenBank is from the 5' end of the transcript. The co-ordinates with respect to M87321.1 refer to the GenBank numbering. |
Chemistry: | RNA |
Strand: | antisense |
Label: | S35 |