| Type: | in situ hybridisation probe |
| Identifier: | MGI:3763128 |
| Entity Detected: | Fbxl16, F-box and leucine-rich repeat protein 16 ( MGI:2448488) |
| Sequence: | sense strand is shown
>MGI:3763128
TCGTGCTGGACAGGTGTGTACGCATCACGGACACTGGTCTCAGCTACTTGTCCACCATGTCGTCCCTCCG
CAGCCTCTACCTGCGATGGTGCTGCCAGGTGCAGGACTTCGGGTTGAAGCACCTCTTAGCCATGAGAAGT
TTGCGAC
|
| | nt 1130 - nt 1276 of NM_001009504.1 |
| Notes: | The Fbxl16 (scirr1) probe template used in this study by Liu et al., 2007 [PMID:17603280] is described as follows:
"Blast search against the rat mRNA database of GenBank revealed that the 147 bp fragment from nucleotides 1,130 to 1,276 is the most specific sequence of the rat scirr1 coding region. This fragment covers the 3' part of the third exon and the 5' part of the fourth exon, which enables probe derived from this fragment to identify scirr1 mRNA specifically. Then this fragment was amplified using primers 5'-CTGGAATTCGTCGCAAACTTCTCATGGCTAA-3' and 5'-TACAAGCTTTCGTGCTGGACAGGTGTGTAC-3', and the PCR product was inserted into the pSPT19 vector (Roche, Grenzacherstrasse, Basel, Switzerland) between the EcoRI and HindIII sites."
Editors Note: It is assumed the template sequence was amplified from a rat mRNA source, although it is not specifically stated by the authors. |
| Chemistry: | RNA |
| Strand: | antisense |
| Label: | digoxigenin |