Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:6310

Alkbh4 alkB, alkylation repair homolog 4 (E. coli) ( MGI:1919291)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:6310 EMAGE:6310 EMAGE:6310 EMAGE:6310 EMAGE:6310
"Pseudo-wholemount" of euxassay_016190. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_016190_01 euxassay_016190_02 euxassay_016190_03 euxassay_016190_04
EMAGE:6310 EMAGE:6310 EMAGE:6310 EMAGE:6310 EMAGE:6310
euxassay_016190_05 euxassay_016190_06 euxassay_016190_07 euxassay_016190_08 euxassay_016190_09
EMAGE:6310 EMAGE:6310 EMAGE:6310 EMAGE:6310 EMAGE:6310
euxassay_016190_10 euxassay_016190_11 euxassay_016190_12 euxassay_016190_13 euxassay_016190_14
EMAGE:6310 EMAGE:6310 EMAGE:6310 EMAGE:6310 EMAGE:6310
euxassay_016190_15 euxassay_016190_16 euxassay_016190_17 euxassay_016190_18 euxassay_016190_19
EMAGE:6310 EMAGE:6310 EMAGE:6310 EMAGE:6310 EMAGE:6310
euxassay_016190_20 euxassay_016190_21 euxassay_016190_22 euxassay_016190_23 euxassay_016190_24
EMAGE:6310 EMAGE:6310
euxassay_016190_25 euxassay_016190_26

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:6310Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
6310_wholemount_strong.wlz
6310_wholemount_moderate.wlz
6310_wholemount_weak.wlz
6310_wholemount_possible.wlz
6310_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:6310_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Annotation Validation: spatial mapping by EMAGE editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:T45579
Entity Detected:Alkbh4, alkB, alkylation repair homolog 4 (E. coli) ( MGI:1919291)
Sequence:sense strand is shown

>T45579
CCTTGGACTCTTGCCTTTTCTACCTCCTCTTCCCAAGCTCTGGCTTGATTATTTTGTTTTGTTTCTCTTT
TTGGGACAGGGTCTCCGGCCTAGACTGGCCTCAGACTCTGTTTCCAGCCAAGGATGACTTTGAACTCCGG
ATCCTCCTGCCTCTACCTCTTGAATGCTGGGATTGCCAGCGTGCACCATCATATGCAATTTTTGTCTGTG
CTGGGATGGCAGCAAGCGTTCTGCCAGCTGAGCTACCCCACCCCCCTAGCCTGTTGGGGGTTTTTGAGAC
AAGGCCTCACATGGGCTAGACTGGCCTGGAACTCCCCATCCTCCTGCCTCAGCCTCCCAGTCGCTGAGGT
GACAGTGTACTGGTGAGGTTTTAGGAGGAGCCATCTGACCCTTGACGTCATGAG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from genomic DNA prepared from tail-tips of two wild-type C57BL/6J mice), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 201417. Forward Primer - name:201417_F_exon_2010004B12Rik, sequence:CCTTGGACTCTTGCCTTTTCTA; Reverse Primer - name:201417_N_SP6_exon_2010004B12Rik, sequence:CTCATGACGTCAAGGGTCAGA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:6311 same embryo
 EMAGE:6314 same embryo
 EMAGE:6312 same embryo
 EMAGE:6315 same embryo
 EMAGE:6313 same embryo
 EurExpress:euxassay_016190 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS