Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:6570

Mir676 microRNA 676 ( MGI:3629957)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:6570 EMAGE:6570 EMAGE:6570 EMAGE:6570 EMAGE:6570
"Pseudo-wholemount" of euxassay_019060. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019060_01 euxassay_019060_02 euxassay_019060_03 euxassay_019060_04
EMAGE:6570 EMAGE:6570 EMAGE:6570 EMAGE:6570 EMAGE:6570
euxassay_019060_05 euxassay_019060_06 euxassay_019060_07 euxassay_019060_08 euxassay_019060_09
EMAGE:6570 EMAGE:6570 EMAGE:6570 EMAGE:6570 EMAGE:6570
euxassay_019060_10 euxassay_019060_11 euxassay_019060_12 euxassay_019060_13 euxassay_019060_14
EMAGE:6570 EMAGE:6570 EMAGE:6570 EMAGE:6570 EMAGE:6570
euxassay_019060_15 euxassay_019060_16 euxassay_019060_17 euxassay_019060_18 euxassay_019060_19
EMAGE:6570 EMAGE:6570 EMAGE:6570 EMAGE:6570 EMAGE:6570
euxassay_019060_20 euxassay_019060_21 euxassay_019060_22 euxassay_019060_23 euxassay_019060_24
EMAGE:6570 EMAGE:6570
euxassay_019060_25 euxassay_019060_26

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:6570Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
6570_wholemount_strong.wlz
6570_wholemount_moderate.wlz
6570_wholemount_weak.wlz
6570_wholemount_possible.wlz
6570_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:6570_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
weak weak
regionalweak expression: see section 03 04 05 06 07 09 10 17 21 22 23 24 25
humerus
moderate moderate
regionalmoderate expression: see section 01 02 weak expression: see section 03 25 26
fibula
weak weak
regionalweak expression: see section 04 05 06
tibia
weak weak
regionalweak expression: see section 05
femur
weak weak
regionalweak expression: see section 06 07 08 10 25 26
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 17 weak expression: see section 10 11 18
pons mantle layer
weak weak
regionalweak expression: see section 09 19
ventral grey horn
moderate moderate
regionalmoderate expression: see section 17 18 weak expression: see section 12 13 14 15
axial skeleton
weak weak
regionalweak expression: see section 09 10 17
exoccipital bone
weak weak
regionalweak expression: see section 05 06 21 22 23
temporal bone
weak weak
regionalweak expression: see section 02 03 04 05 06 21 22 23 25
orbito-sphenoid
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 17 18 19 20 21 22 23 24 25
viscerocranium
weak weak
regionalExpression in the turbinate bone.
scapula
weak weak
regionalweak expression: see section 03 04 24
pelvic girdle skeleton
weak weak
regionalweak expression: see section 13 21
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T70125
Entity Detected:Mir676, microRNA 676 ( MGI:3629957)
Sequence:sense strand is shown

>T70125
CCGTCCTGAGGTTGTTGAGCT
Notes:The probe used by the EURExpress consortium to detect the presence of miRNA mmu-miR-676 was custom designed and ordered from Sigma-Exiqon by the EURExpress partner in Geneva and then distributed to the ISH generating units within the consortium.
Chemistry:LNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:6568 same embryo
 EMAGE:6569 same embryo
 EurExpress:euxassay_019060 same experiment
 MGI:4826358 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS