Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:6585

Mir670 microRNA 670 ( MGI:3629629)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:6585 EMAGE:6585 EMAGE:6585 EMAGE:6585 EMAGE:6585
"Pseudo-wholemount" of euxassay_019051. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019051_01 euxassay_019051_02 euxassay_019051_03 euxassay_019051_04
EMAGE:6585 EMAGE:6585 EMAGE:6585 EMAGE:6585 EMAGE:6585
euxassay_019051_05 euxassay_019051_06 euxassay_019051_07 euxassay_019051_08 euxassay_019051_09
EMAGE:6585 EMAGE:6585 EMAGE:6585 EMAGE:6585 EMAGE:6585
euxassay_019051_10 euxassay_019051_11 euxassay_019051_12 euxassay_019051_13 euxassay_019051_14
EMAGE:6585 EMAGE:6585 EMAGE:6585 EMAGE:6585 EMAGE:6585
euxassay_019051_15 euxassay_019051_16 euxassay_019051_17 euxassay_019051_18 euxassay_019051_19
EMAGE:6585 EMAGE:6585 EMAGE:6585 EMAGE:6585
euxassay_019051_20 euxassay_019051_21 euxassay_019051_22 euxassay_019051_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:6585Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
6585_wholemount_strong.wlz
6585_wholemount_moderate.wlz
6585_wholemount_weak.wlz
6585_wholemount_possible.wlz
6585_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:6585_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 07 18
trigeminal v ganglion
weak weak
regionalweak expression: see section 03 04 05 06 07 08 17 18 19 20 21
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 16 17
neural retina
weak weak
regionalweak expression: see section 01 02 03 21 22 23
mandible
moderate moderate
regionalmoderate expression: see section 05 06 07 08 16 17 18 19 20 weak expression: see section 09 15
maxilla
moderate moderate
regionalmoderate expression: see section 16 weak expression: see section 09 15
clavicle
moderate moderate
regionalmoderate expression: see section 06 07 17 18 19 weak expression: see section 08
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T70116
Entity Detected:Mir670, microRNA 670 ( MGI:3629629)
Sequence:sense strand is shown

>T70116
ATCCCTGAGTGTATGTGGTGAA
Notes:The probe used by the EURExpress consortium to detect the presence of miRNA mmu-miR-670 was custom designed and ordered from Sigma-Exiqon by the EURExpress partner in Geneva and then distributed to the ISH generating units within the consortium.
Chemistry:LNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:6586 same embryo
 EMAGE:6595 same embryo
 EMAGE:6596 same embryo
 EMAGE:6597 same embryo
 EMAGE:6598 same embryo
 EMAGE:6587 same embryo
 EMAGE:6588 same embryo
 EMAGE:6589 same embryo
 EMAGE:6590 same embryo
 EMAGE:6591 same embryo
 EMAGE:6592 same embryo
 EMAGE:6593 same embryo
 EMAGE:6594 same embryo
 EurExpress:euxassay_019051 same experiment
 MGI:4826353 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS