Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:6596

Mir669a-1k microRNA 669a-1k ( MGI:3719594)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:6596 EMAGE:6596 EMAGE:6596 EMAGE:6596 EMAGE:6596
"Pseudo-wholemount" of euxassay_019048. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019048_01 euxassay_019048_02 euxassay_019048_03 euxassay_019048_04
EMAGE:6596 EMAGE:6596 EMAGE:6596 EMAGE:6596 EMAGE:6596
euxassay_019048_05 euxassay_019048_06 euxassay_019048_07 euxassay_019048_08 euxassay_019048_09
EMAGE:6596 EMAGE:6596 EMAGE:6596 EMAGE:6596 EMAGE:6596
euxassay_019048_10 euxassay_019048_11 euxassay_019048_12 euxassay_019048_13 euxassay_019048_14
EMAGE:6596 EMAGE:6596 EMAGE:6596 EMAGE:6596 EMAGE:6596
euxassay_019048_15 euxassay_019048_16 euxassay_019048_17 euxassay_019048_18 euxassay_019048_19
EMAGE:6596 EMAGE:6596 EMAGE:6596 EMAGE:6596
euxassay_019048_20 euxassay_019048_21 euxassay_019048_22 euxassay_019048_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:6596Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
6596_wholemount_strong.wlz
6596_wholemount_moderate.wlz
6596_wholemount_weak.wlz
6596_wholemount_possible.wlz
6596_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:6596_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 10 11 13 14 15 16 17 weak expression: see section 08 09 12
cerebral cortex mantle layer
moderate moderate
regionalmoderate expression: see section 05 06 13 14 17 21 22 weak expression: see section 07 08 10 11 12 18 19 20
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 05 06 10 16 21 22 23 weak expression: see section 07 11 18 19 20
olfactory cortex mantle layer
moderate moderate
regionalmoderate expression: see section 10 14 15 16 weak expression: see section 09 11
medulla oblongata alar plate mantle layer
moderate moderate
regionalmoderate expression: see section 13 16 17 weak expression: see section 08 09 10 11 12 14 15
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 13 16 17 weak expression: see section 09 10 11 12 14 15
rest of cerebellum mantle layer
moderate moderate
regionalmoderate expression: see section 16 17 20 21 weak expression: see section 05 06 07 08 18 19
pons mantle layer
moderate moderate
regionalmoderate expression: see section 13 16 17 weak expression: see section 07 08 09 10 11 12 14 15 18
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 06 07 08 10 11 12 13 14 15 16 17 18 weak expression: see section 09 19
glossopharyngeal ix ganglion
weak weak
single cellweak expression: see section 17
trigeminal v ganglion
moderate moderate
single cellmoderate expression: see section 05 06 16 17 18 19 20 21 weak expression: see section 07 09
dorsal grey horn
moderate moderate
regionalmoderate expression: see section 13 14 weak expression: see section 10 11 12
ventral grey horn
moderate moderate
regionalmoderate expression: see section 13 14 weak expression: see section 10 11 15
dorsal root ganglion
moderate moderate
single cellmoderate expression: see section 08 09 13 15 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T70113
Entity Detected:Mir669a-1k, microRNA 669a-1k ( MGI:3719594)
Sequence:sense strand is shown

>T70113
AGTTGTGTGTGCATGTTCATGT
Notes:The probe used by the EURExpress consortium to detect the presence of miRNA mmu-miR-669a was custom designed and ordered from Sigma-Exiqon by the EURExpress partner in Geneva and then distributed to the ISH generating units within the consortium.
Chemistry:LNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:6586 same assay
 EurExpress:euxassay_019048 same experiment
 EMAGE:6597 same assay
 EMAGE:6598 same assay
 EMAGE:6587 same assay
 EMAGE:6588 same assay
 EMAGE:6589 same assay
 EMAGE:6590 same assay
 EMAGE:6591 same assay
 EMAGE:6592 same assay
 EMAGE:6593 same assay
 EMAGE:6594 same assay
 EMAGE:6585 same embryo
 EMAGE:6595 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS