Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:6619

Mir678 microRNA 678 ( MGI:3629884)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:6619 EMAGE:6619 EMAGE:6619 EMAGE:6619 EMAGE:6619
"Pseudo-wholemount" of euxassay_019061. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019061_01 euxassay_019061_02 euxassay_019061_03 euxassay_019061_04
EMAGE:6619 EMAGE:6619 EMAGE:6619 EMAGE:6619 EMAGE:6619
euxassay_019061_05 euxassay_019061_06 euxassay_019061_07 euxassay_019061_08 euxassay_019061_09
EMAGE:6619 EMAGE:6619 EMAGE:6619 EMAGE:6619 EMAGE:6619
euxassay_019061_10 euxassay_019061_11 euxassay_019061_12 euxassay_019061_13 euxassay_019061_14
EMAGE:6619 EMAGE:6619 EMAGE:6619 EMAGE:6619 EMAGE:6619
euxassay_019061_15 euxassay_019061_16 euxassay_019061_17 euxassay_019061_18 euxassay_019061_19
EMAGE:6619 EMAGE:6619 EMAGE:6619 EMAGE:6619 EMAGE:6619
euxassay_019061_20 euxassay_019061_21 euxassay_019061_22 euxassay_019061_23 euxassay_019061_24
EMAGE:6619
euxassay_019061_25

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:6619Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
6619_wholemount_strong.wlz
6619_wholemount_moderate.wlz
6619_wholemount_weak.wlz
6619_wholemount_possible.wlz
6619_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:6619_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 06 07 08 09 17 weak expression: see section 10 11 12 13 14 15 16 18
cerebral cortex mantle layer
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 17 21 22 weak expression: see section 10 11 13 15 16 18 19 20 23 24
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 21 22 25 weak expression: see section 18 19 20 23 24
olfactory cortex mantle layer
moderate moderate
regionalmoderate expression: see section 17 weak expression: see section 10 11 15 16 18
medulla oblongata alar plate mantle layer
moderate moderate
regionalmoderate expression: see section 08 09 weak expression: see section 10 11 15 16 17
medulla oblongata basal plate mantle layer
weak weak
regionalweak expression: see section 10 11 13 14 15 16 17
medulla oblongata basal plate marginal layer
moderate moderate
regionalmoderate expression: see section 09
rest of cerebellum mantle layer
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 weak expression: see section 04 10 11 14 15 16 17 18 19 20 21 22
pons mantle layer
moderate moderate
regionalmoderate expression: see section 07 08 09 weak expression: see section 10 11 12 13 14 15 16 17 18 19
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 05 06 08 09 17 weak expression: see section 10 11 12 13 14 15 16 18
midbrain marginal layer
moderate moderate
regionalmoderate expression: see section 07
trigeminal v ganglion
moderate moderate
single cellmoderate expression: see section 05 weak expression: see section 04 06 07 08 09 18 19 20 21
dorsal grey horn
moderate moderate
regionalmoderate expression: see section 13 weak expression: see section 10 11 12 14 15 16
ventral grey horn
moderate moderate
regionalmoderate expression: see section 13 weak expression: see section 10 11 12 14 15 16
dorsal root ganglion
moderate moderate
single cellmoderate expression: see section 18 weak expression: see section 10 11 13 14 15 16 17 19
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T70127
Entity Detected:Mir678, microRNA 678 ( MGI:3629884)
Sequence:sense strand is shown

>T70127
GTCTCGGTGCAAGGACTGGAGG
Notes:The probe used by the EURExpress consortium to detect the presence of miRNA mmu-miR-678 was custom designed and ordered from Sigma-Exiqon by the EURExpress partner in Geneva and then distributed to the ISH generating units within the consortium.
Chemistry:LNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:6620 same embryo
 EurExpress:euxassay_019061 same experiment
 MGI:4826359 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS