Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:6770

Ankra2 ankyrin repeat, family A (RFXANK-like), 2 ( MGI:1915808)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:6770 EMAGE:6770 EMAGE:6770 EMAGE:6770 EMAGE:6770
"Pseudo-wholemount" of euxassay_007349. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007349_01 euxassay_007349_02 euxassay_007349_03 euxassay_007349_04
EMAGE:6770 EMAGE:6770 EMAGE:6770 EMAGE:6770 EMAGE:6770
euxassay_007349_05 euxassay_007349_06 euxassay_007349_07 euxassay_007349_08 euxassay_007349_09
EMAGE:6770 EMAGE:6770 EMAGE:6770 EMAGE:6770 EMAGE:6770
euxassay_007349_10 euxassay_007349_11 euxassay_007349_12 euxassay_007349_13 euxassay_007349_14
EMAGE:6770 EMAGE:6770 EMAGE:6770 EMAGE:6770 EMAGE:6770
euxassay_007349_15 euxassay_007349_16 euxassay_007349_17 euxassay_007349_18 euxassay_007349_19
EMAGE:6770 EMAGE:6770 EMAGE:6770 EMAGE:6770 EMAGE:6770
euxassay_007349_20 euxassay_007349_21 euxassay_007349_22 euxassay_007349_23 euxassay_007349_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:6770Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
6770_wholemount_strong.wlz
6770_wholemount_moderate.wlz
6770_wholemount_weak.wlz
6770_wholemount_possible.wlz
6770_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:6770_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 14
telencephalon ventricular layer
strong strong
regionalstrong expression: see section 14 15 moderate expression: see section 03 04 05 06 07 08 09 10 16 17 18 19 20
medulla oblongata basal plate ventricular layer
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
pons ventricular layer
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19 20
midbrain ventricular layer
strong strong
regionalstrong expression: see section 10 11 12 14 15 16 17 18 moderate expression: see section 13
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1955
Entity Detected:Ankra2, ankyrin repeat, family A (RFXANK-like), 2 ( MGI:1915808)
Sequence:sense strand is shown

>T1955
GACGGGCTCGGCGCCGGCTTTGTCTGTCTGCGGGCGCGCGCCGCTGCGGTTCTCCAGACCAGCCCATGGA
AGAATCATATGAAGAGGCGGTGATCAAAGTCAGCGAGCAGGAGTGGACATGTTTGGGTTCCCAACAGCTA
CCCTGCTGGACTGTCATGGAAGATACGCCCAGAATGTAGCCTTTTTCAATGTGATGACAGAAGCCCACAA
GTATGATCCTTCAGAGGCCACAGGATCCTCAAGCTGGGATTTCCAGAGCTCTTTCAGAAGAGAGAAGCTG
GAACAAAAGTCCCCGGAGTCTAAGGCCCTCCAGGAAGACTCACCTGGAGTGAGGCAGAAGGTCTATGGAT
TGCCAGGAATGTGGGAAGTCTTTCCGGCAGAAAGGGAGCCTAACGCTGCACGAGAGAATCCACACTGGTC
AGAAGCCCTTTGAGTGCACCCAGTGTGGGAAAAGCTTCAGGGCCAAGGGCAACCTGGTTACACATCAGCG
GATCCACACAGGAGAGAAGCCCTATCAGT
Notes:The probe template was PCR amplified from IMAGE:640212 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:640212 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:6771 same assay
 EMAGE:6768 same embryo
 EurExpress:euxassay_007349 same experiment
 MGI:4829327 same experiment
 EMAGE:6769 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS