Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:7165

Herc2 hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 2 ( MGI:103234)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:7165 EMAGE:7165 EMAGE:7165 EMAGE:7165 EMAGE:7165
"Pseudo-wholemount" of euxassay_002598. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_002598_01 euxassay_002598_02 euxassay_002598_03 euxassay_002598_04
EMAGE:7165 EMAGE:7165 EMAGE:7165 EMAGE:7165 EMAGE:7165
euxassay_002598_05 euxassay_002598_06 euxassay_002598_07 euxassay_002598_08 euxassay_002598_09
EMAGE:7165 EMAGE:7165 EMAGE:7165 EMAGE:7165 EMAGE:7165
euxassay_002598_10 euxassay_002598_11 euxassay_002598_12 euxassay_002598_13 euxassay_002598_14
EMAGE:7165 EMAGE:7165 EMAGE:7165 EMAGE:7165 EMAGE:7165
euxassay_002598_15 euxassay_002598_16 euxassay_002598_17 euxassay_002598_18 euxassay_002598_19
EMAGE:7165 EMAGE:7165 EMAGE:7165 EMAGE:7165 EMAGE:7165
euxassay_002598_20 euxassay_002598_21 euxassay_002598_22 euxassay_002598_23 euxassay_002598_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:7165Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
7165_wholemount_strong.wlz
7165_wholemount_moderate.wlz
7165_wholemount_weak.wlz
7165_wholemount_possible.wlz
7165_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:7165_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
brain
moderate moderate
homogeneousmoderate expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 05 06 07 08 20 21 22 23
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 08 09 20 21
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 18 19 20 21 22 23 24
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 08 09 10 19 20
spinal cord
moderate moderate
homogeneousmoderate expression: see section 13 14 15 16 17 18 19 20
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 18 weak expression: see section 11
cervical ganglion
moderate moderate
regionalmoderate expression: see section 18 19 weak expression: see section 10
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15 18 19 20 21
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2066
Entity Detected:Herc2, hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 2 ( MGI:103234)
Sequence:sense strand is shown

>T2066
TGGCCTCGAGCAGATTCGGCACGAGGGTAAAGGTGGGTTAGCTGGCCCTGATGGCACCAAGTCTGTCTTT
GGGCAGATGTGTGCTAAGATGAGTTCCTTCAGTCCTGACAGCCTTCTCCTTCCTCACCGAGTCTGGAAAG
TCAAGTTTGTGGGTGAATCCGTGGACGACTGTGGTGGTGGCTACAGTGAGTCTATAGCAGAGATTTGTGA
GGAGCTGCAAAACGGACTCACACCTCTTCTGATTGTGACTCCCAATGGCAGGGATGAGTCTGGTGCCAAC
AGAGACTGTTACCTATTAAACCCTGCCACCCGTGCACCCGTGCACTGCAGCATGTTCCGATTCCTAGGGG
TGTTATTGGGCATTGCCATCCGAACTGGGAGTCCACTAAGTTTGAATCTTGCTGAACCTGTATGGAAGCA
GCTGGCTGGGATGAGCCTCACCATTGCAGACCTGAGTGAGGTAGATAAAGATTTTATTCCTGGGCTTATG
TACATTCGTGACAATGAAGCCACTTCAGAGGAATTTGAGGCTATGAGCCTGCCC
Notes:The probe template was PCR amplified from IMAGE:820814 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:820814 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:7164 same embryo
 EMAGE:7163 same embryo
 EMAGE:7166 same embryo
 EurExpress:euxassay_002598 same experiment
 MGI:4825356 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS