Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8705

Syt5 synaptotagmin V ( MGI:1926368)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8705 EMAGE:8705 EMAGE:8705 EMAGE:8705 EMAGE:8705
"Pseudo-wholemount" of euxassay_009990. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009990_01 euxassay_009990_02 euxassay_009990_03 euxassay_009990_04
EMAGE:8705 EMAGE:8705 EMAGE:8705 EMAGE:8705 EMAGE:8705
euxassay_009990_05 euxassay_009990_06 euxassay_009990_07 euxassay_009990_08 euxassay_009990_09
EMAGE:8705 EMAGE:8705 EMAGE:8705 EMAGE:8705 EMAGE:8705
euxassay_009990_10 euxassay_009990_11 euxassay_009990_12 euxassay_009990_13 euxassay_009990_14
EMAGE:8705 EMAGE:8705 EMAGE:8705 EMAGE:8705 EMAGE:8705
euxassay_009990_15 euxassay_009990_16 euxassay_009990_17 euxassay_009990_18 euxassay_009990_19
EMAGE:8705 EMAGE:8705 EMAGE:8705 EMAGE:8705 EMAGE:8705
euxassay_009990_20 euxassay_009990_21 euxassay_009990_22 euxassay_009990_23 euxassay_009990_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8705Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8705_wholemount_strong.wlz
8705_wholemount_moderate.wlz
8705_wholemount_weak.wlz
8705_wholemount_possible.wlz
8705_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8705_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
brain
strong strong
regionalstrong expression: see section 24 moderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
facial vii ganglion
strong strong
regionalstrong expression: see section 03 04 05 06 18 21
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 05 06 17 18 19
trigeminal v ganglion
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 17 18 21 22 moderate expression: see section 19 20
vagus x ganglion
strong strong
regionalstrong expression: see section 07 17
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 05 moderate expression: see section 06 07 08 17 18 19
trigeminal v nerve
moderate moderate
regionalmoderate expression: see section 10 17 18
spinal cord
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15
cervico-thoracic ganglion
weak weak
regionalweak expression: see section 09 10 16
cervical ganglion
weak weak
regionalweak expression: see section 08 09 16 17
thoracic ganglion
weak weak
regionalweak expression: see section 11 12
dorsal root ganglion
strong strong
regionalstrong expression: see section 06 07 08 09 12 13 14 15 16 17
neural retina
moderate moderate
regionalmoderate expression: see section 01 02 03 04 23 24
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 09 12 13 14 16 17 18 19 weak expression: see section 10 11
vomeronasal organ
moderate moderate
regionalmoderate expression: see section 14 17
tongue
moderate moderate
spottedmoderate expression: see section 13
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31731
Entity Detected:Syt5, synaptotagmin V ( MGI:1926368)
Sequence:sense strand is shown

>T31731
GAATTGGGTCCCCCAAAGCCTGCCACTGGCGTGAAGAGGCTGAGATTAACTCCTAGTGTGCACCAAAAAT
CAATGGAATTTAAGGTTCTTTGATGCGTGAGAAAACTCACTGGATGCTTTGGGTAGGAGTGGGGTGGGGT
GGGGATAGAGTATTTGGGTACCTCTGCAGGAAGCACCGCAGGACCCCGACGCCATGTTCCCGGAACCCCC
GACCCTGGGGTCTCCAGCGCCTAAGACACCTCCAGACTCCAGCCGCATCAGGCAGGGCGCAGTGCCTGCC
TGGGTCCTGGCTACCATCGTGCTGGGCTCGGGCCTCCTGGTCTTCAGCAGTTGTTTCTGTCTCTACCGGA
AGCGCTGTCGGAGACGGATGGGCAAAAAGAGTCAGGCCCAAGCCCAAGTCCATCTTCAGGAAGTGAAGGA
GCTGGGCCGGAGTTACATAGATAAGGTTCAGCCTGAAATAGAGGAGCTGGACCGGTCACCATCCATGCCT
GGACAGCAGGTATCAGACAAACACCAGCTAGGCCGACTGCAGTATTCACTGGACTATGACTTCCAGACTG
GCCAGCTCCTGGTGGGCATCTTGCAAGCTCAGGGACTGGCTGCGTTGGACCTAGGAGGTTCCTCAGATCC
CTATGTTAGTGTCTATCTGCTGCCAGACAAGCGGAGGCGACATGAGACCAAGGTGCATCGGCAGACCCTG
AATCCACACTTTGGAGAGACATTTGCCTTCAAGGTCCCATACGTGGAACTAGGGGGCAGAGTGCTGGTCA
TGGCGGTGTATGACTTTGATCGGTTCTCCCGCAACGATGCCATCGGGGAGGTGCGGGTGCCTATGAGT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:6465481), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 58091. Forward Primer - name:058091_F_IRAV91_c04_Syt5, sequence:GAATTGGGTCCCCCAAAG; Reverse Primer - name:058091_R_SP6_IRAV91_c04_Syt5, sequence:AACTCATAGGCACCCGCA. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8704 same embryo
 EMAGE:8706 same embryo
 EMAGE:8707 same embryo
 EMAGE:8703 same embryo
 EMAGE:8708 same embryo
 EurExpress:euxassay_009990 same experiment
 MGI:4828573 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS