Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8706

Mapk10 mitogen-activated protein kinase 10 ( MGI:1346863)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8706 EMAGE:8706 EMAGE:8706 EMAGE:8706 EMAGE:8706
"Pseudo-wholemount" of euxassay_009977. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009977_01 euxassay_009977_02 euxassay_009977_03 euxassay_009977_04
EMAGE:8706 EMAGE:8706 EMAGE:8706 EMAGE:8706 EMAGE:8706
euxassay_009977_05 euxassay_009977_06 euxassay_009977_07 euxassay_009977_08 euxassay_009977_09
EMAGE:8706 EMAGE:8706 EMAGE:8706 EMAGE:8706 EMAGE:8706
euxassay_009977_10 euxassay_009977_11 euxassay_009977_12 euxassay_009977_13 euxassay_009977_14
EMAGE:8706 EMAGE:8706 EMAGE:8706 EMAGE:8706 EMAGE:8706
euxassay_009977_15 euxassay_009977_16 euxassay_009977_17 euxassay_009977_18 euxassay_009977_19
EMAGE:8706 EMAGE:8706 EMAGE:8706 EMAGE:8706 EMAGE:8706
euxassay_009977_20 euxassay_009977_21 euxassay_009977_22 euxassay_009977_23 euxassay_009977_24
EMAGE:8706
euxassay_009977_25

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8706Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8706_wholemount_strong.wlz
8706_wholemount_moderate.wlz
8706_wholemount_weak.wlz
8706_wholemount_possible.wlz
8706_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8706_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
brain
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 weak expression: see section 01 25
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 05 07 weak expression: see section 04 19
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 06 18
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 17 18 weak expression: see section 03 04 19 20 21 22
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 07 17 18
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 06 07 08 17 18
trigeminal v nerve
weak weak
regionalweak expression: see section 10
spinal cord
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 10 weak expression: see section 16
cervical ganglion
moderate moderate
regionalmoderate expression: see section 17 weak expression: see section 08 09 16
thoracic ganglion
moderate moderate
regionalmoderate expression: see section 11 weak expression: see section 12 15
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 17 weak expression: see section 08 09 12 13 14 15 16
neural retina
weak weak
regionalweak expression: see section 02 03 04 24 25
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15 16 17 18 19 weak expression: see section 20
vomeronasal organ
moderate moderate
regionalmoderate expression: see section 14 17
stomach
moderate moderate
spottedmoderate expression: see section 05 06 07 08 09 10 weak expression: see section 01 02 03 04
midgut
moderate moderate
spottedmoderate expression: see section 17 weak expression: see section 11 16 18
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31730
Entity Detected:Mapk10, mitogen-activated protein kinase 10 ( MGI:1346863)
Sequence:sense strand is shown

>T31730
TGCAGCCCACAGTCAGAAACTACGTGGAGAATCGGCCCAAGTACGCAGGACTCACCTTCCCCAAGCTCTT
TCCAGATTCCCTCTTCCCAGCGGATTCTGAGCACAATAAACTTAAAGCCAGCCAAGCCAGGGATTTGTTG
TCTAAGATGTTAGTGATTGACCCAGCGAAGAGGATATCGGTGGACGACGCACTGCAGCATCCGTACATCA
ACGTTTGGTACGACCCGGCTGAAGTGGAGGCGCCTCCGCCTCAGATATATGATAAGCAGCTGGATGAAAG
GGAGCACACCATCGAAGAATGGAAAGAACTTATCTACAAGGAGGTAATGAACTCAGAAGAGAAGACTAAG
AATGGCGTAGTCAAAGGCCAGCCCTCGCCTTCAGGTGCAGCAGTGAACAGCAGTGAGAGTCTCCCTCCAT
CCTCGTCTGTCAACGACATCTCCTCCATGTCCACCGACCAGACCCTCGCATCTGACACTGACAGCAGCCT
GGAGGCCTCGGCGGGACCGTTGGGTTGTTGCAGGTG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:6494163), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 58173. Forward Primer - name:058173_F_IRAV91_b12_Mapk10, sequence:TGCAGCCCACAGTCAGAA; Reverse Primer - name:058173_R_SP6_IRAV91_b12_Mapk10, sequence:TCACCTGCAACAACCCAA. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8704 same embryo
 EMAGE:8707 same embryo
 EMAGE:8703 same embryo
 EMAGE:8705 same embryo
 EMAGE:8708 same embryo
 EurExpress:euxassay_009977 same experiment
 MGI:4826086 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS