Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8742

Zwint ZW10 interactor ( MGI:1289227)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8742 EMAGE:8742 EMAGE:8742 EMAGE:8742 EMAGE:8742
"Pseudo-wholemount" of euxassay_009942. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009942_01 euxassay_009942_02 euxassay_009942_03 euxassay_009942_04
EMAGE:8742 EMAGE:8742 EMAGE:8742 EMAGE:8742 EMAGE:8742
euxassay_009942_05 euxassay_009942_06 euxassay_009942_07 euxassay_009942_08 euxassay_009942_09
EMAGE:8742 EMAGE:8742 EMAGE:8742 EMAGE:8742 EMAGE:8742
euxassay_009942_10 euxassay_009942_11 euxassay_009942_12 euxassay_009942_13 euxassay_009942_14
EMAGE:8742 EMAGE:8742 EMAGE:8742 EMAGE:8742 EMAGE:8742
euxassay_009942_15 euxassay_009942_16 euxassay_009942_17 euxassay_009942_18 euxassay_009942_19
EMAGE:8742 EMAGE:8742 EMAGE:8742 EMAGE:8742 EMAGE:8742
euxassay_009942_20 euxassay_009942_21 euxassay_009942_22 euxassay_009942_23 euxassay_009942_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8742Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8742_wholemount_strong.wlz
8742_wholemount_moderate.wlz
8742_wholemount_weak.wlz
8742_wholemount_possible.wlz
8742_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8742_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
brain
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
facial vii ganglion
strong strong
regionalstrong expression: see section 04 05 19 20 21 moderate expression: see section 06
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 19 moderate expression: see section 07 18
trigeminal v ganglion
strong strong
regionalstrong expression: see section 04 05 08 09 19 20 21 22 moderate expression: see section 03 06 07 17 18 23
vagus x ganglion
strong strong
regionalstrong expression: see section 07 08 18
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 19 moderate expression: see section 06 07 18
trigeminal v nerve
moderate moderate
regionalmoderate expression: see section 10 17
spinal cord
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 10 13 14 16 17
cervical ganglion
moderate moderate
regionalmoderate expression: see section 09 17
thoracic ganglion
moderate moderate
regionalmoderate expression: see section 10 11 12
dorsal root ganglion
strong strong
regionalstrong expression: see section 09 10 14 15 16 17 moderate expression: see section 07 08 18
neural retina
strong strong
regionalstrong expression: see section 01 02 03 04 23 24
heart valve
moderate moderate
regionalmoderate expression: see section 11 14
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31088
Entity Detected:Zwint, ZW10 interactor ( MGI:1289227)
Sequence:sense strand is shown

>T31088
AGAAAAACGCTGTTGCGGAGAAAAACAACGCTGTTGCGACGAAAGAGGTTCTGGCTGAGGCAGCAGCCAT
TCTAGAACCTGTAGGCTTGCAGGAAGAAGCAGAGCTGCCTGCCAAGATCATGGAGGAGTTTATGAGGAAC
TCGCGGAAGAAAGACAAACTGCTCTGTAGCCAGCTTCAAGTAGTGAACTTCTTACAGACTTTTCTGGCTC
AGGAGGACACTGAGCAGAGCCCTGATGCTCTGGCTTCTGAAGATGCCAGTCGGCAAAAGGCAACTGAAAC
TAAGGAGCAGTGGAAGGACATGAAGGCCACATACATGGATCACGTGGATGTCATAAAATGTGCCCTGTCT
GAGGCCTTACCCCAGGTTAAAGAGGCTCACAGGAAGTACACAGAGCTTCAGAAGGCTTTTGAGCAACTCG
AGGCTAAGAAGCGAGTCCTTGAGGAGAAACTTCAGCTGGCTCAGAAGCAGTGGGTACTGCAACAGAAGCG
TTTGCAGAACCTGACAAAGATTTCTGCAGAGGTCAAGAGGCGCCGGAAGAGGGCTCTGGAGAAGCTTGAC
GGATCCCATCAGGAACTGGAAACCTTGAAGCAGCAAGCGGGGCAGGAACAGGAGAAGCTGCAGAGGAACC
AGAGCTACCTCCAGCTGCTGTGTTCGCTGCAGAATAAGCTGGTCATCTCTGAGGGCAAGGCTGAGGACAA
AGATGTGAAAGGGCGAGCCCTTACAGCCAAATCCAAATCTCCTTAAAGATGAAAGGATGAGAAGAGAGCC
GTATTCATACCCTGCTTGGGCTGAGACCAGATTGGTTCCTTCACTGTTGTATCTCTAGGCCTAAGCCTGG
AAGTTTGTTGCCTCTGTACAATCTAATTCTCCAAGCTGATTCAATCTGGCATCTCTTGG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:1382192), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 56811. Forward Primer - name:056811_F_IRAV41_e02_Zwint, sequence:AGAAAAACGCTGTTGCGG; Reverse Primer - name:056811_R_SP6_IRAV41_e02_Zwint, sequence:GCCAAGAGATGCCAGATTG. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8744 same embryo
 EMAGE:8741 same embryo
 EMAGE:8740 same embryo
 EMAGE:8739 same embryo
 EMAGE:8743 same embryo
 EurExpress:euxassay_009942 same experiment
 MGI:4829372 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS