Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:9014

Galntl6 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 6 ( MGI:1913581)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:9014 EMAGE:9014 EMAGE:9014 EMAGE:9014 EMAGE:9014
"Pseudo-wholemount" of euxassay_013046. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_013046_01 euxassay_013046_02 euxassay_013046_03 euxassay_013046_04
EMAGE:9014 EMAGE:9014 EMAGE:9014 EMAGE:9014 EMAGE:9014
euxassay_013046_05 euxassay_013046_06 euxassay_013046_07 euxassay_013046_08 euxassay_013046_09
EMAGE:9014 EMAGE:9014 EMAGE:9014 EMAGE:9014 EMAGE:9014
euxassay_013046_10 euxassay_013046_11 euxassay_013046_12 euxassay_013046_13 euxassay_013046_14
EMAGE:9014 EMAGE:9014 EMAGE:9014 EMAGE:9014 EMAGE:9014
euxassay_013046_15 euxassay_013046_16 euxassay_013046_17 euxassay_013046_18 euxassay_013046_19
EMAGE:9014 EMAGE:9014 EMAGE:9014 EMAGE:9014 EMAGE:9014
euxassay_013046_20 euxassay_013046_21 euxassay_013046_22 euxassay_013046_23 euxassay_013046_24
EMAGE:9014 EMAGE:9014 EMAGE:9014
euxassay_013046_25 euxassay_013046_26 euxassay_013046_27

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:9014Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
9014_wholemount_strong.wlz
9014_wholemount_moderate.wlz
9014_wholemount_weak.wlz
9014_wholemount_possible.wlz
9014_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:9014_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
hypothalamus mantle layer
moderate moderate
regionalmoderate expression: see section 10 16 weak expression: see section 09 14 15
diencephalon lateral wall mantle layer
weak weak
regionalweak expression: see section 09 10 11 12 13 14 16 17 18
thalamus mantle layer
moderate moderate
regionalmoderate expression: see section 09 10 16 weak expression: see section 15 17
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 10 11 16 17 18 weak expression: see section 04 05 06 07 09 12 13 14 15 19 20 21 22
medulla oblongata alar plate mantle layer
weak weak
regionalweak expression: see section 17
medulla oblongata basal plate mantle layer
weak weak
regionalweak expression: see section 09 10 11 13 14 15 17
pons mantle layer
weak weak
regionalweak expression: see section 09 10 11 13 14 15 16 17 18 19
spinal cord mantle layer
weak weak
regionalweak expression: see section 10 11 13 14 15 16 17 18
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T38167
Entity Detected:Galntl6, UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 6 ( MGI:1913581)
Sequence:sense strand is shown

>T38167
AGGAAAGAGGAAAGGACTTTGGCATTAAACTCAAGAAGTAGTCTGGGAGACATCTCTAACTTTTCTCCAT
TGTTATCCTTTGCAATGAAGAGGAAACAGAAGAGGTTTCTGCAAATGACTTTGTTATTCACCGTGGCTTT
AATTTTCCTGCCCAACATTGGTCTCTGGTCTTTGTACAAGGATAAACACCTGGTGAAATCTGCAGAACCC
GCGGAGCATCAGACATTTCCACTGGGCCTAGGAGATGGGCAATTCTATTCCTGGACAGATGGTCTGAGAA
GAAAAGACTGGCATGACTATGAGAGCATTCAGAGAGATGCTTTGCGCTCAGGGAAAGGTGAACATGGAAA
ACCATACCCACTTACTGAAGAGGACCGGGATGACTCAGCTTACAGGGAAAATGGCTTCAACATTTTTGTC
AGCAACAATATTGCTCTAGAGAGGTCTCTGCCAGACATCCGCCATGCCAACTGTAAGCACAAGATGTACC
TTGAAAGGCTGCCAAACACCAGCATCATTATCCCATTTCACAACGAAGGTTGGACCTCACTCTTGCGGAC
CATACACAGTATAATCAACCGAACACCAGAGAGTCTGATAGCAGAA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 105217. Forward Primer - name:105217_F_cDNA_A830023L05, sequence:AGGAAAGAGGAAAGGACTTTGG; Reverse Primer - name:105217_N_SP6_cDNA_A830023L05, sequence:TTCTGCTATCAGACTCTCTGGTG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:9011 same embryo
 EMAGE:9012 same embryo
 EMAGE:9010 same embryo
 EMAGE:9013 same embryo
 EurExpress:euxassay_013046 same experiment
 MGI:4824989 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS