Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:9956

Flrt1 fibronectin leucine rich transmembrane protein 1 ( MGI:3026647)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:9956 EMAGE:9956 EMAGE:9956 EMAGE:9956 EMAGE:9956
"Pseudo-wholemount" of euxassay_008157. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_008157_01 euxassay_008157_02 euxassay_008157_03 euxassay_008157_04
EMAGE:9956 EMAGE:9956 EMAGE:9956 EMAGE:9956 EMAGE:9956
euxassay_008157_05 euxassay_008157_06 euxassay_008157_07 euxassay_008157_08 euxassay_008157_09
EMAGE:9956 EMAGE:9956 EMAGE:9956 EMAGE:9956 EMAGE:9956
euxassay_008157_10 euxassay_008157_11 euxassay_008157_12 euxassay_008157_13 euxassay_008157_14
EMAGE:9956 EMAGE:9956 EMAGE:9956 EMAGE:9956 EMAGE:9956
euxassay_008157_15 euxassay_008157_16 euxassay_008157_17 euxassay_008157_18 euxassay_008157_19
EMAGE:9956 EMAGE:9956 EMAGE:9956 EMAGE:9956 EMAGE:9956
euxassay_008157_20 euxassay_008157_21 euxassay_008157_22 euxassay_008157_23 euxassay_008157_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:9956Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
9956_wholemount_strong.wlz
9956_wholemount_moderate.wlz
9956_wholemount_weak.wlz
9956_wholemount_possible.wlz
9956_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:9956_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
cerebral cortex mantle layer
moderate moderate
regionalmoderate expression: see section 05 06 07 14 15 16 17 18 19 20 21 22 23 24 weak expression: see section 03 04 08 09 10 11 13
ventral grey horn
moderate moderate
regionalmoderate expression: see section 17 18 19 weak expression: see section 13 14 15 16 20
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 14 15 16 17 18
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T54
Entity Detected:Flrt1, fibronectin leucine rich transmembrane protein 1 ( MGI:3026647)
Sequence:sense strand is shown

>T54
GTGGGGTTTCTCTTCCTGGCTCCTGGTGTTGCAGTGGGCTAGACAGAGCCACGTGACACACCGGTGCGGT
GCGGCGCGGGCGGCCAGCTTCATGTGTAGGAGTAGTCCACATCAGGGATGCCCGCTTCCCGGTAGCCTCG
TGTGGTGCCATAGCCAATAGTGTGGGCACCCTTGCAGAGGCTGCTGCCATTGGAGGGAAATATGGTGTGC
ACCACGTACTCCTCTTTGGAGCGGTACGGGTTGATGGGTAGCATCTGCAGTCCTGGGCCACGGATTTCTA
GAATGGAGTTATCCTTCTTGGTCCCTGACTCCATGTAGTCGTCCTTCCTCCTGCTGCCCCTGTTGTAGAC
CCTCTCTCGGGTCAGCAGCTCGCCAGCCCGGTGCACGTACCAGCAAATGGCTCCCAGGACCAGGAAGAGA
AATACAAGAGCCACGGCACCACCAATAATCCCAGCCAGGGGCAGCCCCGCCATAGGGCCAGCATTCTGTT
CCTGGTTGAGCGTGGTGGTAGGGCCA
Notes:The probe template was PCR amplified from IMAGE:1107727 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1107727 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:NMRI
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:9957 same embryo
 EurExpress:euxassay_008157 same experiment
 MGI:4824880 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS