EMAGE mouse gene expression spatial database

EMAGE:10042

Bpifb5 BPI fold containing family B, member 5 ( MGI:2385160)
TS23 (14.5 dpc)
in situ hybridisation

Data Images


"Pseudo-wholemount" of euxassay_008196. This image has been made by aligning and collapsing the constitutent sections. Information about the method.	euxassay_008196_01	euxassay_008196_02	euxassay_008196_03	euxassay_008196_04

euxassay_008196_05	euxassay_008196_06	euxassay_008196_07	euxassay_008196_08	euxassay_008196_09

euxassay_008196_10	euxassay_008196_11	euxassay_008196_12	euxassay_008196_13	euxassay_008196_14

euxassay_008196_15	euxassay_008196_16	euxassay_008196_17	euxassay_008196_18	euxassay_008196_19

euxassay_008196_20	euxassay_008196_21	euxassay_008196_22

View assay images:
Expression pattern clarity:
Find spatially similar wholemount expression patterns:

Expression Pattern Description

Spatial Annotation:

Annotation colour key:

wholemount mapping

Download individual expression domains:

Download all expression domains:

Find spatially similar wholemount expression patterns:

Morphological match to the template:

Text Annotation:

Structure

Level

Pattern

Notes

nasal cavity olfactory epithelium

strong

regional

strong expression: see section 07 15 16

Annotation Validation:

spatial mapping by EMAGE editor, text annotation by author

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	T387
Entity Detected:	Bpifb5, BPI fold containing family B, member 5 ( MGI:2385160)
Sequence:	sense strand is shown >T387 CAGGGATGCTGCTGCTGTGGGCACTGCTGTTATGCTGGGGGGTGCTGCCCCAAGCCCGAGGGGCAACCCA CACTCATCTCTTCCTGCGGATCAACAATAGCCAGCTGGAAACAGACATCTCAAATCTATTATCAGAGAAC CAGGTCCTGGAGGGTATGATCAGGATGGCTGTGACTGGATCCCCAAGTGAGGGTGTGTCTGTCATGGACT CCCTGCCCTTCGTCAGAGAGGAGCTCGTTGACAAGAAGAGTGGGCTGGATCTGTCATTGGTGGGGGACCT GCTCTCTGGGAAGACTATGCCTGAGCTGAAGAAACTGCTGACGACAGCCGGGTTGGTCATAGAAGATGCC AAGGGACCAGAAGTCACCCTGCAAATTCTAAGTGACAGCCTGCTGCAGATCACACTGCGCTGCAAGCTGT ACCTCTCATTCCTAGAGATCCTCTGGCTGGAAGCCATCAAGAACATACGAATTGGAGTACGGCTAGAACA GATAGGGAAC
Notes:	The probe template was PCR amplified from IMAGE:3156626 using vector specific primers. Forward Primer - name:RZPD T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template using T7 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:3156626 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:	RNA
Strand:	antisense
Label:	digoxigenin

Specimen

Procedures

Fixation:	none
Embedding:	cryosection (OCT)
Staining procedure:	alkaline phosphatase + NBT/BCIP

General Information

Authors:	Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:	Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	screen
References:	[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:	EMAGE:10044 same embryo
	EMAGE:10043 same embryo
	EurExpress:euxassay_008196 same experiment
	MGI:4823413 same experiment
	Ensembl same gene
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source