Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10085

Palm paralemmin ( MGI:1261814)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10085 EMAGE:10085 EMAGE:10085 EMAGE:10085 EMAGE:10085
"Pseudo-wholemount" of euxassay_000027. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_000027_01 euxassay_000027_02 euxassay_000027_03 euxassay_000027_04
EMAGE:10085 EMAGE:10085 EMAGE:10085 EMAGE:10085 EMAGE:10085
euxassay_000027_05 euxassay_000027_06 euxassay_000027_07 euxassay_000027_08 euxassay_000027_09
EMAGE:10085 EMAGE:10085 EMAGE:10085 EMAGE:10085 EMAGE:10085
euxassay_000027_10 euxassay_000027_11 euxassay_000027_12 euxassay_000027_13 euxassay_000027_14
EMAGE:10085 EMAGE:10085 EMAGE:10085 EMAGE:10085 EMAGE:10085
euxassay_000027_15 euxassay_000027_16 euxassay_000027_17 euxassay_000027_18 euxassay_000027_19
EMAGE:10085 EMAGE:10085 EMAGE:10085 EMAGE:10085 EMAGE:10085
euxassay_000027_20 euxassay_000027_21 euxassay_000027_22 euxassay_000027_23 euxassay_000027_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10085Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10085_wholemount_strong.wlz
10085_wholemount_moderate.wlz
10085_wholemount_weak.wlz
10085_wholemount_possible.wlz
10085_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10085_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
central nervous system
moderate moderate
homogeneousmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
central nervous system ganglion
strong strong
homogeneousstrong expression: see section 09 10 19 20 21
cranial ganglion
strong strong
homogeneousstrong expression: see section 08 19 20 21
facial vii ganglion
strong strong
homogeneousstrong expression: see section 06 07 22 23
trigeminal v ganglion
strong strong
homogeneousstrong expression: see section 04 05 06 07 22 23 24
vestibulocochlear viii ganglion
strong strong
homogeneousstrong expression: see section 07 22
central nervous system nerve
strong strong
homogeneousstrong expression: see section 10
peripheral nervous system
strong strong
homogeneousstrong expression: see section 15 16 17 18 19 20 21
autonomic nervous system
strong strong
homogeneousstrong expression: see section 11 12 13 14 15 16 17 18 19 20 21 22 moderate expression: see section 06
spinal component of peripheral nervous system
strong strong
homogeneousstrong expression: see section 11 12 13 14 18 19 20 21
retina
moderate moderate
homogeneousmoderate expression: see section 03 04
nasal cavity olfactory epithelium
moderate moderate
homogeneousmoderate expression: see section 10 11 12 13 16 17 18 19 20
vomeronasal organ epithelium
moderate moderate
homogeneousmoderate expression: see section 16
liver
moderate moderate
homogeneousmoderate expression: see section 03 weak expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 18 19 20 21 23 24
renal cortex
strong strong
spottedstrong expression: see section 09 10 11 12 19 20 moderate expression: see section 23
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1711
Entity Detected:Palm, paralemmin ( MGI:1261814)
Sequence:sense strand is shown

>T1711
TGGCCTCGAGCCAGATTCGGACGAGGGTGGAGTGAGGCCACAGTTCTTTGGGGACTCAAAGTCTTGAAGT
TCTAGGGAGGAGGATGGGCACCTGTGGATCCCCTCCCATAGGTAGCAGAGCTCAAAGCAGGGGAAACTCT
TCACCGGGGATAGAACAATCACCCGCAGGATGGAGTCATTGTTGGCCAGCCAAGCCACTCCCTGTCCTGA
GTCCCACCCCCACCCCCACCATGCACACACTGGGCCCTTCTTCCTGGTGCTAATTTTGGGAGCTTTGGGG
TCACCTCTGCCCTCTTCTCTAGTTGGTTTGGACCAGGGTCCTGGGTTTCCCACATACCCCCATACCCTAG
AAGTCAGTGGGTATGTCTGCCAGCGCCACAAAACCTAGCATATCCAGGCAGGTTTAGGCTGCTCCACACA
CACTTTGGGTGGGAGTAAGGGACCCCCCCCCATCTGCCACCTGGCCTGACGGGAGCCTGGCAGAGGGTCA
CCAACCTTCGGGCAGGCAGCAGTAGCCACTTTGGTCCCCAGAGGCACAACCCTGCACACAGGAGCTGACT
CAAC
Notes:The probe template was PCR amplified from IMAGE:478371 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:478371 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10084 same embryo
 EurExpress:euxassay_000027 same experiment
 MGI:4827033 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS