Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10088

Slc25a39 solute carrier family 25, member 39 ( MGI:1196386)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10088 EMAGE:10088 EMAGE:10088 EMAGE:10088 EMAGE:10088
"Pseudo-wholemount" of euxassay_000139. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_000139_01 euxassay_000139_02 euxassay_000139_03 euxassay_000139_04
EMAGE:10088 EMAGE:10088 EMAGE:10088 EMAGE:10088 EMAGE:10088
euxassay_000139_05 euxassay_000139_06 euxassay_000139_07 euxassay_000139_08 euxassay_000139_09
EMAGE:10088 EMAGE:10088 EMAGE:10088 EMAGE:10088 EMAGE:10088
euxassay_000139_10 euxassay_000139_11 euxassay_000139_12 euxassay_000139_13 euxassay_000139_14
EMAGE:10088 EMAGE:10088 EMAGE:10088 EMAGE:10088 EMAGE:10088
euxassay_000139_15 euxassay_000139_16 euxassay_000139_17 euxassay_000139_18 euxassay_000139_19
EMAGE:10088 EMAGE:10088 EMAGE:10088 EMAGE:10088
euxassay_000139_20 euxassay_000139_21 euxassay_000139_22 euxassay_000139_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10088Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10088_wholemount_strong.wlz
10088_wholemount_moderate.wlz
10088_wholemount_weak.wlz
10088_wholemount_possible.wlz
10088_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10088_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
moderate moderate
homogeneousmoderate expression: see section 03 04 weak expression: see section 05 06
spleen primordium
moderate moderate
homogeneousmoderate expression: see section 18 weak expression: see section 10 19
submandibular gland primordium
strong strong
regionalstrong expression: see section 08 09 10 11 12 18 19 20 21
gut
moderate moderate
regionalmoderate expression: see section 09 15 16
pancreas
strong strong
regionalstrong expression: see section 13 moderate expression: see section 12
physiological umbilical hernia
strong strong
homogeneousstrong expression: see section 18 19 moderate expression: see section 12 13 14 15 16
vibrissa
moderate moderate
regionalmoderate expression: see section 11 12 weak expression: see section 10
cerebral cortex ventricular layer
strong strong
homogeneousstrong expression: see section 08 moderate expression: see section 07
telencephalon ventricular layer
strong strong
homogeneousstrong expression: see section 09 10 11 moderate expression: see section 13 18 19 20 21 22 weak expression: see section 23
midbrain ventricular layer
weak weak
gradedweak expression: see section 12 14
cranial ganglion
moderate moderate
homogeneousmoderate expression: see section 04
facial vii ganglion
strong strong
homogeneousstrong expression: see section 12 moderate expression: see section 18
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 08
trigeminal v ganglion
strong strong
homogeneousstrong expression: see section 09 12 17 moderate expression: see section 04 08 10 11 19 weak expression: see section 22
vagus x ganglion
strong strong
regionalstrong expression: see section 09 17 moderate expression: see section 04 08 11 18 19
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 04 11 19
facial vii nerve
moderate moderate
homogeneousmoderate expression: see section 18
oculomotor iii nerve
strong strong
homogeneousstrong expression: see section 12 moderate expression: see section 18
optic ii nerve
moderate moderate
regionalmoderate expression: see section 12
trigeminal v nerve
weak weak
homogeneousweak expression: see section 22
trigeminal v nerve mandibular division
moderate moderate
regionalmoderate expression: see section 12 14
trigeminal v nerve maxillary division
moderate moderate
regionalmoderate expression: see section 12
trigeminal v nerve ophthalmic division
moderate moderate
regionalmoderate expression: see section 12 weak expression: see section 22
autonomic nervous system
moderate moderate
regionalmoderate expression: see section 09 10
autonomic nerve plexus
moderate moderate
regionalmoderate expression: see section 09 10 11 14 weak expression: see section 12 15
hypogastric plexus
moderate moderate
regionalmoderate expression: see section 08
sympathetic nervous system
moderate moderate
regionalmoderate expression: see section 07
dorsal root ganglion
strong strong
homogeneousstrong expression: see section 16 17 moderate expression: see section 07 18 weak expression: see section 13 15
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 17 18 19
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 17 18 19
liver
strong strong
spottedstrong expression: see section 13 14 16 17 18 22 23 moderate expression: see section 03 07 08 09 10 12 15 19 21 weak expression: see section 04 06
urinary system
moderate moderate
regionalmoderate expression: see section 19
metanephros
moderate moderate
regionalmoderate expression: see section 19 weak expression: see section 10 11
testis
strong strong
regionalstrong expression: see section 21 moderate expression: see section 22
skeleton
weak weak
regionalweak expression: see section 05
nucleus pulposus
weak weak
regionalweak expression: see section 11
pectoral girdle and thoracic body wall skeleton
moderate moderate
homogeneousmoderate expression: see section 04
scapula
strong strong
regionalstrong expression: see section 03 moderate expression: see section 04
pelvic girdle skeleton
moderate moderate
regionalmoderate expression: see section 04 weak expression: see section 05
foregut-midgut junction lumen
moderate moderate
regionalmoderate expression: see section 14 15 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T330
Entity Detected:Slc25a39, solute carrier family 25, member 39 ( MGI:1196386)
Sequence:sense strand is shown

>T330
CCAAGCTGCAGGCTCAGCATGTGTCATACCGTGAGCTGGCTTCCTCTGTTCAAGCTGCGGTGACTCAGGG
TGGCTGGCGCTCTCTGTGGCTGGGCTGGGGTCCCACAGCTCTTCGAGATGTCCCCTTCTCAGCTCTGTAC
TGGTTCAACTACGAGTTGGTGAAGAGCTGGCTGAGCGGACTGAGACCAAAAGACCAGACATCGGTGGGCA
TCAGCTTCGTGGCCGGTGGCATCTCAGGAATGGTGGCTGCCACCCTTACCCTACCCTTCGATGTGGTGAA
GACACAGCGACAGATGTCACTGGGAGCGGTGGAGGCTGTGAGAGTGAAGCCGCCCAGAGTGGACTCCACC
TGGCTCCTGCTTCGCAGAATCCGGGCTGAATCTGGCACCAGGGGACTCTTTGCAGGCTTCCTCCCCAGGA
TCATCAAGGCTGCACCCTCCTGTGCCATCATGATCAGCACTTACGAGTTTGGCAAAAGCTTC
Notes:The probe template was PCR amplified from IMAGE:3154476 using vector specific primers. Forward Primer - name:RZPD T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template using T7 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:3154476 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10086 same embryo
 EMAGE:10087 same embryo
 EurExpress:euxassay_000139 same experiment
 MGI:4828161 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS