Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10179

Slc16a2 solute carrier family 16 (monocarboxylic acid transporters), member 2 ( MGI:1203732)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10179 EMAGE:10179 EMAGE:10179 EMAGE:10179 EMAGE:10179
"Pseudo-wholemount" of euxassay_019716. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019716_01 euxassay_019716_02 euxassay_019716_03 euxassay_019716_04
EMAGE:10179 EMAGE:10179 EMAGE:10179 EMAGE:10179 EMAGE:10179
euxassay_019716_05 euxassay_019716_06 euxassay_019716_07 euxassay_019716_08 euxassay_019716_09
EMAGE:10179 EMAGE:10179 EMAGE:10179 EMAGE:10179 EMAGE:10179
euxassay_019716_10 euxassay_019716_11 euxassay_019716_12 euxassay_019716_13 euxassay_019716_14
EMAGE:10179 EMAGE:10179 EMAGE:10179 EMAGE:10179 EMAGE:10179
euxassay_019716_15 euxassay_019716_16 euxassay_019716_17 euxassay_019716_18 euxassay_019716_19
EMAGE:10179 EMAGE:10179 EMAGE:10179
euxassay_019716_20 euxassay_019716_21 euxassay_019716_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10179Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10179_wholemount_strong.wlz
10179_wholemount_moderate.wlz
10179_wholemount_weak.wlz
10179_wholemount_possible.wlz
10179_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10179_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
pericardium
moderate moderate
spottedmoderate expression: see section 10 11 12 13 14 15 16 17 18 19
interdigital region between hindlimb digits 1 and 2
moderate moderate
regionalmoderate expression: see section 07 weak expression: see section 09
interdigital region between hindlimb digits 2 and 3
moderate moderate
regionalmoderate expression: see section 07 weak expression: see section 09
interdigital region between hindlimb digits 3 and 4
weak weak
regionalweak expression: see section 08
interdigital region between hindlimb digits 4 and 5
weak weak
regionalweak expression: see section 08 09
vertebral axis musculature
weak weak
regionalweak expression: see section 03 04 05 06 07 08 09 10 11 17 18 19 20 21 22
thyroid gland
strong strong
regionalstrong expression: see section 12 13 17 18
pituitary gland
moderate moderate
regionalmoderate expression: see section 12 13 14 15 16 17
vibrissa
weak weak
regionalweak expression: see section 08 09 10 11 22
cerebral cortex mantle layer
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 11 12 14 16 17 18 20 21 22 weak expression: see section 02 09 10 13 19
lateral ventricle choroid plexus
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19 20
metencephalon part of 4th ventricle choroid plexus
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 05 06 07 21
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 08 19
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 07 09 10 11 19 20 21 22 weak expression: see section 08
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 17 18
lower jaw incisor
weak weak
regionalweak expression: see section 14 17 18
upper jaw incisor
weak weak
regionalweak expression: see section 14 17 18
lung
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 15 16 17 18 19 20 21 22 weak expression: see section 14
clavicle
weak weak
regionalweak expression: see section 12 16 18
tail mesenchyme
moderate moderate
regionalmoderate expression: see section 15 16 weak expression: see section 19
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T56037
Entity Detected:Slc16a2, solute carrier family 16 (monocarboxylic acid transporters), member 2 ( MGI:1203732)
Sequence:sense strand is shown

>T56037
AGGCATCCTGAACCACTCTGCTGAGTGGGCATTATAGGTGCCAAAAAAAGTAGGCTCTGGACCACCATCA
TCCCTTTGAAGTTGGTGCCAAATATTTTCCTACATCCAGGCTCTGGGCAACAGTCTTACTGAAGCACATT
CCAAGTGCCCCTGGCCAAAGGCAAAGGGCACTGCCAGCCTCGTCCAGTTGTACGGCTCACCTCATTAGGG
ACTCAGCCTCTCTCCTCCCTGTTTCTCTCTCTCTCTGTGTCTCTCTCTCTGTCTTTGTTTATTGTGTTCC
TGTACCAACCTTTTATCATCTTTTTGCCAGGCATCCTGGCTGTTACTTGGACCCAACAATAACTTGCCAC
CCCAAGCTAGGGTCATCCCAAGGCCAGGAAGATGAGGTTGCTCTGAGGGGCTCCAAAGAATACAATGGTC
CCCACACATGAGTTTTTCCGTTACTAACAGGCAGCTGGGGCATAGTTGGCCTCTGATGTTTCATTCAAGG
CCAAAGTCCTGAGCCCCCCTCTGCTGGTCCCAATCCAGCTCTTATCAACTCCCCAAAGGAAAACCCATTG
GTTCTTGGCTCTGAGGACAGGAAGGGGTGGAGTCACTGTCCTGTCAACTCAAGCATCTATGGAACAGGAG
AAGCTGGGCCCCAGGAGCCCTGCGACTTCCCAGGAAGAGGCCATTGAAAATACTGAAGCAACAATGCTTC
CACTTCCATTTCTCCTTACCCCACCCCCTTCCAGGCCATTTAGGGGGTAGGGGGCAGAATAAGTGTGCAG
GGCTTCCTTTGTTGCTCATGGCTGGACAGCTCTAAAGAGTCAGGCTGCCACTCACTTTTCTCCAGATGAT
GGAAAGACATTCACAGGTCCCAGATTTGCCCATTCAGGTGTCACCTAACATTGGCAGGGTGTCAA
Notes:The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers. Forward Primer - name:unspecified, sequence:AGGCATCCTGAACCACTCTG; Reverse Primer - name:unspecified, sequence:TTGACACCCTGCCAATGTTA. The reverse primer contains a 5' extension containing an unspecified RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using unspecified polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:MGI:4828111 same experiment
 EurExpress:euxassay_019716 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS