Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10210

Me2 malic enzyme 2, NAD(+)-dependent, mitochondrial ( MGI:2147351)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10210 EMAGE:10210 EMAGE:10210 EMAGE:10210 EMAGE:10210
"Pseudo-wholemount" of euxassay_000082. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_000082_01 euxassay_000082_02 euxassay_000082_03 euxassay_000082_04
EMAGE:10210 EMAGE:10210 EMAGE:10210 EMAGE:10210 EMAGE:10210
euxassay_000082_05 euxassay_000082_06 euxassay_000082_07 euxassay_000082_08 euxassay_000082_09
EMAGE:10210 EMAGE:10210 EMAGE:10210 EMAGE:10210 EMAGE:10210
euxassay_000082_10 euxassay_000082_11 euxassay_000082_12 euxassay_000082_13 euxassay_000082_14
EMAGE:10210 EMAGE:10210 EMAGE:10210 EMAGE:10210 EMAGE:10210
euxassay_000082_15 euxassay_000082_16 euxassay_000082_17 euxassay_000082_18 euxassay_000082_19
EMAGE:10210 EMAGE:10210 EMAGE:10210 EMAGE:10210 EMAGE:10210
euxassay_000082_20 euxassay_000082_21 euxassay_000082_22 euxassay_000082_23 euxassay_000082_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10210Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10210_wholemount_strong.wlz
10210_wholemount_moderate.wlz
10210_wholemount_weak.wlz
10210_wholemount_possible.wlz
10210_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10210_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
strong strong
regionalstrong expression: see section 04 05 06 07 09 moderate expression: see section 03 08 21 22 23 24
thymus primordium
weak weak
homogeneousweak expression: see section 14
physiological umbilical hernia
moderate moderate
regionalmoderate expression: see section 15 16 17 18 weak expression: see section 14
trigeminal v ganglion
strong strong
regionalstrong expression: see section 03 04 06 07 09 19 21 moderate expression: see section 08 18 20 24
vagus x ganglion
strong strong
regionalstrong expression: see section 07 09 19 moderate expression: see section 08
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 21 weak expression: see section 07
dorsal root ganglion
strong strong
regionalstrong expression: see section 09 18 19 moderate expression: see section 10 11 17 weak expression: see section 16
lower jaw skeleton
moderate moderate
regionalmoderate expression: see section 20
mandible
strong strong
regionalstrong expression: see section 07 08 09 19 moderate expression: see section 10 11 20
lower jaw tooth
moderate moderate
regionalmoderate expression: see section 08
nucleus pulposus
weak weak
regionalweak expression: see section 14
frontal bone primordium
strong strong
regionalstrong expression: see section 04 05 moderate expression: see section 03 24 weak expression: see section 01 02
clavicle
strong strong
regionalstrong expression: see section 10
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2301
Entity Detected:Me2, malic enzyme 2, NAD(+)-dependent, mitochondrial ( MGI:2147351)
Sequence:sense strand is shown

>T2301
TGGCCTCGAGCCAGATTCGTCGACATGCGATGGGTCGCCTCCTGCGCTCTGCTTTAAGCTTGCGACGGTA
CTGTCGCTGTTAACGTGAATGTATCTCTCACTTCCCCCCTCAGCCCTCCAGTGCTGTGCACGTGAGCACA
GAACGTTGAGAAGGAGTGAGTGCTCACCAAATTCCAAAGAAAACTTGTCAGCACCAAGAAACTGCTCTGT
TCTTGTCACTTTCTGCTCTGATGTCCCTTTGTAGTTAGACAGATTTGGGGAAATACAAAAAAAACTTCCT
AGAACTAAATCAGTGCTAACTAGCATTATAGAAGAGTGGGAGGAGCCACTGCTGCCTTTAGACAAACTGG
ACTGTCACGTGCAACAGTGTACAAAACCCACTTTTATTAATAAAAGTAATTCCTTACAAAAAAAAAAAAA
AA
Notes:The probe template was PCR amplified from IMAGE:1137120 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1137120 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10211 same embryo
 EurExpress:euxassay_000082 same experiment
 MGI:4826146 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS