Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10670

Sel1l3 sel-1 suppressor of lin-12-like 3 (C. elegans) ( MGI:1916941)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10670 EMAGE:10670 EMAGE:10670 EMAGE:10670 EMAGE:10670
"Pseudo-wholemount" of euxassay_000894. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_000894_01 euxassay_000894_02 euxassay_000894_03 euxassay_000894_04
EMAGE:10670 EMAGE:10670 EMAGE:10670 EMAGE:10670 EMAGE:10670
euxassay_000894_05 euxassay_000894_06 euxassay_000894_07 euxassay_000894_08 euxassay_000894_09
EMAGE:10670 EMAGE:10670 EMAGE:10670 EMAGE:10670 EMAGE:10670
euxassay_000894_10 euxassay_000894_11 euxassay_000894_12 euxassay_000894_13 euxassay_000894_14
EMAGE:10670 EMAGE:10670 EMAGE:10670 EMAGE:10670 EMAGE:10670
euxassay_000894_15 euxassay_000894_16 euxassay_000894_17 euxassay_000894_18 euxassay_000894_19
EMAGE:10670 EMAGE:10670 EMAGE:10670 EMAGE:10670 EMAGE:10670
euxassay_000894_20 euxassay_000894_21 euxassay_000894_22 euxassay_000894_23 euxassay_000894_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10670Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10670_wholemount_strong.wlz
10670_wholemount_moderate.wlz
10670_wholemount_weak.wlz
10670_wholemount_possible.wlz
10670_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10670_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
submandibular gland primordium
strong strong
regionalstrong expression: see section 07 08 09 10 17 18 19 20
cerebral cortex
strong strong
homogeneousstrong expression: see section 02 03 04 05 06 07 08 09 10 11 18 19 20 21 22 23 24 moderate expression: see section 01
corpus striatum
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 09 11 18 19 20 21 22 23
olfactory cortex marginal layer
strong strong
homogeneousstrong expression: see section 10 11 12 15 16 18
medulla oblongata basal plate
moderate moderate
regionalmoderate expression: see section 09 15 16 weak expression: see section 08
trigeminal v ganglion
moderate moderate
homogeneousmoderate expression: see section 03 04 05 06 07 08 09 18 19 21 22 weak expression: see section 20
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 11 12 13 17 18 19 weak expression: see section 09 10 16
kidney calyx
moderate moderate
homogeneousmoderate expression: see section 08 09 10 11 18 19 20 21 22
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2170
Entity Detected:Sel1l3, sel-1 suppressor of lin-12-like 3 (C. elegans) ( MGI:1916941)
Sequence:sense strand is shown

>T2170
TGGCCTCGAGGCAGATTCGGACGAGGCGNCCGAGGCGAGCTGAGGCTTTGGACTTTCCTTCCTGGTGACT
GTTCTGGGAACCGCAGTCCATATGTGGAGCGTCCATATAGAGTCATTTTTAAAAGTTTTAGTCTGTCTTC
ATCCCCTTTTACCAGAGAATAGGAACTTATCTCCAAGGCTGACTGACGATGCTTCAGTACCTCTGTTTGC
CACCGCATCCTGCTCCGCAAAAGCCCAGCTGGTTGCTCTCTGAGTCCCAAATCCAGCAGCTAGAAGGAGC
CTTGAGACAAACACTCCACACACAGGGAAGGCGATAACATTGTACATTGGTTTACATTTTTTCCCCCTGT
GGATTTTTCTAGAGGTCATAGTGCTTCCAAATCATTTGATGACATTATTGGGTATCGTTTATGTTTCCAT
CATAACACATGCAATAACATCTAGGAAATCTTTACCGTTTAAGTGTAGTCTGCTTCCCCATGAGTCACCA
TTAGAATAGACTGGCAGCAATGGAATACGCAGACAAAAAACAAGCTGTTAGTTCATA
Notes:The probe template was PCR amplified from IMAGE:876859 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:876859 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10672 same embryo
 EMAGE:10674 same embryo
 EMAGE:10669 same embryo
 EMAGE:10671 same embryo
 EMAGE:10673 same embryo
 EurExpress:euxassay_000894 same experiment
 MGI:4827939 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS