Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:11179

Gtf2h5 general transcription factor IIH, polypeptide 5 ( MGI:107227)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:11179 EMAGE:11179 EMAGE:11179 EMAGE:11179 EMAGE:11179
"Pseudo-wholemount" of euxassay_001235. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_001235_01 euxassay_001235_02 euxassay_001235_03 euxassay_001235_04
EMAGE:11179 EMAGE:11179 EMAGE:11179 EMAGE:11179 EMAGE:11179
euxassay_001235_05 euxassay_001235_06 euxassay_001235_07 euxassay_001235_08 euxassay_001235_09
EMAGE:11179 EMAGE:11179 EMAGE:11179 EMAGE:11179 EMAGE:11179
euxassay_001235_10 euxassay_001235_11 euxassay_001235_12 euxassay_001235_13 euxassay_001235_14
EMAGE:11179 EMAGE:11179 EMAGE:11179 EMAGE:11179 EMAGE:11179
euxassay_001235_15 euxassay_001235_16 euxassay_001235_17 euxassay_001235_18 euxassay_001235_19
EMAGE:11179 EMAGE:11179 EMAGE:11179 EMAGE:11179 EMAGE:11179
euxassay_001235_20 euxassay_001235_21 euxassay_001235_22 euxassay_001235_23 euxassay_001235_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:11179Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
11179_wholemount_strong.wlz
11179_wholemount_moderate.wlz
11179_wholemount_weak.wlz
11179_wholemount_possible.wlz
11179_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:11179_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
thymus primordium
moderate moderate
homogeneousmoderate expression: see section 13 14 17 weak expression: see section 15 16
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 18 19 20 21
pancreas
weak weak
regionalweak expression: see section 11 12 13 14
cerebral cortex marginal layer
weak weak
homogeneousweak expression: see section 03 04 05 06 07 08 09 10 11 12 13 15 16 17 18 19 20 21 22 23
telencephalon ventricular layer
weak weak
homogeneousweak expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 16 17 18 19 20 21 22 23 24
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 05 06 22 23
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 07 08 09 19 20
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 18 19 20 21 22 23 weak expression: see section 24
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 10 18
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 07 20
ventral grey horn
weak weak
regionalweak expression: see section 12 13 14 15 16 17
cervico-thoracic ganglion
weak weak
regionalweak expression: see section 12 18
thoracic ganglion
weak weak
regionalweak expression: see section 15 17
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 09 10 11 13 14 18 19 20
esophagus
moderate moderate
regionalmoderate expression: see section 14 15
lower jaw tooth
weak weak
regionalweak expression: see section 06 07 08 09 10 11 12 13 16 17 18 19 20 21 22 not examined expression: see section 14
oral epithelium
weak weak
regionalweak expression: see section 09 10 12 13 14 15 16 17 18 19 20 21 22
upper jaw tooth
weak weak
regionalweak expression: see section 06 07 08 09 10 12 13 14 16 17 18 19 20 21 22
liver lobe
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
renal cortex
weak weak
regionalweak expression: see section 09 10 11 12 13 20 21 22 23 24
chondrocranium
moderate moderate
regionalmoderate expression: see section 05 06 23 24 weak expression: see section 01 02 03 04 22
clavicle
moderate moderate
regionalmoderate expression: see section 09 10 11 12 18 weak expression: see section 19 20
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T4205
Entity Detected:Gtf2h5, general transcription factor IIH, polypeptide 5 ( MGI:107227)
Sequence:sense strand is shown

>T4205
CCGGGCCAGCTCTGGTTTGTTGGAGTTGGAACGCTGCTGCCTCTGCGCGCCTAGAAAAAGAATTCTTGAA
GTCATCTGCACCGTCTGCCTGGGAAAAGATGGTCAACGTGCTGAAAGGGGTGCTTATAGAATGTGACCCT
GCCATGAAGCAGTTCTTGCTGTACTTGGATGAGGCCAACGCCTTGGGGAAGAAGTTCATCATTCAGGACA
TTGATGACACGCACGTCTTCGTCATTGCCGAGCTGGTCAACGTCCTCCAGGAGCGAGTAGGGGAACTGAT
GGACCAGAATGCCTTTTCTCTTACCCAGAAGTGAGAGCGCTGGTGTTGAGCACTTGGGAATCCCAGCCAC
AGACACTTGAGAGAGGCCAGCTCAGTGTCTCGTGGGGTTTATACTTGTTATGAGCATGTCGTGGGAAAGG
CTGCAGGGTCATTCATTCAGATGAAAGCCCCTAACTGATTTGGTTGGACCATTAAAAAAAAAATATGTGT
ACAGAAGAACTTTAGCTGCAAAAAAAAAAAAAAA
Notes:The probe template was PCR amplified from IMAGE:4489531 using vector (pCMV-SPORT6) specific primers. Forward Primer - name:RZPD T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template using Sp6 polymerase. EMAGE Editor's Note: the probe sequence indicated here was given by the EURExpress Consortium and has been checked using a computational method whereby a BLAST comparison was made against the full insert sequence of IMAGE:4489531 which was retrieved directly from NCBI.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:11176 same embryo
 EMAGE:11180 same embryo
 EMAGE:11177 same embryo
 EMAGE:11178 same embryo
 EurExpress:euxassay_001235 same experiment
 MGI:4825277 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS