Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:11204

Ube2e1 ubiquitin-conjugating enzyme E2E 1, UBC4/5 homolog (yeast) ( MGI:107411)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:11204 EMAGE:11204 EMAGE:11204 EMAGE:11204 EMAGE:11204
"Pseudo-wholemount" of euxassay_003420. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_003420_01 euxassay_003420_02 euxassay_003420_03 euxassay_003420_04
EMAGE:11204 EMAGE:11204 EMAGE:11204 EMAGE:11204 EMAGE:11204
euxassay_003420_05 euxassay_003420_06 euxassay_003420_07 euxassay_003420_08 euxassay_003420_09
EMAGE:11204 EMAGE:11204 EMAGE:11204 EMAGE:11204 EMAGE:11204
euxassay_003420_10 euxassay_003420_11 euxassay_003420_12 euxassay_003420_13 euxassay_003420_14
EMAGE:11204 EMAGE:11204 EMAGE:11204 EMAGE:11204 EMAGE:11204
euxassay_003420_15 euxassay_003420_16 euxassay_003420_17 euxassay_003420_18 euxassay_003420_19
EMAGE:11204 EMAGE:11204 EMAGE:11204 EMAGE:11204 EMAGE:11204
euxassay_003420_20 euxassay_003420_21 euxassay_003420_22 euxassay_003420_23 euxassay_003420_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:11204Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
11204_wholemount_strong.wlz
11204_wholemount_moderate.wlz
11204_wholemount_weak.wlz
11204_wholemount_possible.wlz
11204_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:11204_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
adrenal cortex
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 19 20 21 22 23
thymus primordium
moderate moderate
regionalmoderate expression: see section 12 13 14 15 16
submandibular gland primordium
strong strong
regionalstrong expression: see section 07 08 09 10 17 18 19 20
vibrissa
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 20 21 22 23
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 05 22 23
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 08 19
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 18 19 20 21 22 23
not examined not examined
regionalnot examined expression: see section 09
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 07 08 19 20
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 11 17
cervical ganglion
moderate moderate
regionalmoderate expression: see section 10 18
thoracic ganglion
moderate moderate
regionalmoderate expression: see section 14 15 16
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 17 18 19
pharyngo-tympanic tube
weak weak
regionalweak expression: see section 01 02 03 04 23 24
naris
weak weak
regionalweak expression: see section 14 15
nasal cavity olfactory epithelium
weak weak
regionalweak expression: see section 09 10 11 12 13 16 17 18 19
nasal cavity respiratory epithelium
weak weak
regionalweak expression: see section 12 13 16
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 11 12 13 16 17
lower jaw molar
moderate moderate
regionalmoderate expression: see section 07 08 19 20
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 11 12 13 16 17
upper jaw molar
moderate moderate
regionalmoderate expression: see section 07 08 20
bladder
weak weak
regionalweak expression: see section 14 16
urethra of male
weak weak
regionalweak expression: see section 15 16
left lung
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14
right lung
moderate moderate
regionalmoderate expression: see section 15 16 17 18 19 20 21 22 23 24
cranium
moderate moderate
regionalmoderate expression: see section 04 05 06 22 23 24
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 04 05 06 22 23 24
clavicle
moderate moderate
regionalmoderate expression: see section 11 17 18 weak expression: see section 10
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T5954
Entity Detected:Ube2e1, ubiquitin-conjugating enzyme E2E 1, UBC4/5 homolog (yeast) ( MGI:107411)
Sequence:sense strand is shown

>T5954
CACGAGTGGCCAGGCCCAGTCGCAGCCGCAGCAGCAGCCGCGGCGGCGGCACGGAGCAGCCAGACACAAA
GAGAGGGGCCGTTCGCGGGGTGGGGTGGGGGGTTCGCTATGTCGGATGACGATTCGAGGGCCAGCACCAG
CTCCTCGTCATCTTCGTCCTCCAACCAGCAGACCGAGAAAGAAGGCAGCACCCCCAAGAAGAAGGAGAGT
AAAGTCAGCATGAGCAAAAATTCGAAGCTTCTCTCCACCAGCGCTAAGAGGATCCAGAAGGAGCTGGCAG
ACATCACTTTAGACCCTCCGCCAAACTGCAGTGCTGGTCCCAAGGGTGACAACATCTATGAGTGGAGATC
AACCATTCTGGGTCCTCCAGGGTCTGTGTATGAAGGTGGAGTATTCTTCCTTGACATTACTTTTACACCA
GAGTATCCTTTCAAGCCTCCAAAGGTTACATTTCGTACAAGAATTTATCACTGTAATATTAATAGCCAAG
GAGTTATTTGCTTGGACATATTGAAAGACAACTGGAGCCCAGCCCTAACCATCTCGAAAGTCCTCCTTTC
TATCTGCTCACTCCTTACAGACTGCAATCCTGCTGACCCTTTGGTGGGAAGTATTGCCACTCAGTACATG
ACCAACAGAGCAGAACACGACAGAATGGCCAGACAGTGGACCAAGAGATACGCTACATAAACTGGGTTTT
CAGTTCTTACATGATTTGTCTGTCACAGAAGAGAGCTGCTTATGATTTTGAAAGGGTGGGGGTGGGAGTT
GGTAAAGAGTAGGCTATTTCTATATCAGATATTATTCAGTCTTACTTCCCAGGATTTTGTTGTAACTTAA
GGTATCTTGCTACAGTAGACAAACTGGTAATAGCGACTTTTAGAGCTGAAACTTTGCAAGATTAGCTGAC
TTTTAGTACAAAAGAAAGCATGTGTAGATACTTGTGTTCCATTGATCAGCTTAAATTTGTATAGGTACAT
GTCATTTATGTAAAGTCCTATTTTCTTGTTAAAAAAAAAATGGAATTTGTTTTTCCTTCTTAAAAGGAAA
CAATGGTATTTAACAAGTTTGCAAAGATGAGTTTGTTACCTCGTATATGTAAAATGGACACCTGGCTACA
AGACACCATGTAGTTAATGTATTTTATCTTATATGCAAATTACTTCAAGGGTTGAATCACAATTTGTGGA
AACCTGTAGTGAAATACCTTAAGCTGTTAACTGTTAAGTGTGGAATAGGAATTGTTCAGTCAATTGGTTT
AGACTTCTTACGTCTGCATTTGTGCTAATAAACAATATTAAGAACAAAAAAAAAAAAAAA
Notes:The probe template was PCR amplified from IMAGE:3484294 using vector (pCMV-SPORT6) specific primers. Forward Primer - name:RZPD T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template using Sp6 polymerase. EMAGE Editor's Note: the probe sequence indicated here was given by the EURExpress Consortium and has been checked using a computational method whereby a BLAST comparison was made against the full insert sequence of IMAGE:3484294 which was retrieved directly from NCBI.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:11207 same embryo
 EMAGE:11205 same embryo
 EMAGE:11206 same embryo
 EMAGE:11209 same embryo
 EMAGE:11208 same embryo
 EurExpress:euxassay_003420 same experiment
 MGI:4829052 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS