Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:11872

Lama3 laminin, alpha 3 ( MGI:99909)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:11872 EMAGE:11872 EMAGE:11872 EMAGE:11872 EMAGE:11872
"Pseudo-wholemount" of euxassay_011044. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011044_01 euxassay_011044_02 euxassay_011044_03 euxassay_011044_04
EMAGE:11872 EMAGE:11872 EMAGE:11872 EMAGE:11872 EMAGE:11872
euxassay_011044_05 euxassay_011044_06 euxassay_011044_07 euxassay_011044_08 euxassay_011044_09
EMAGE:11872 EMAGE:11872 EMAGE:11872 EMAGE:11872 EMAGE:11872
euxassay_011044_10 euxassay_011044_11 euxassay_011044_12 euxassay_011044_13 euxassay_011044_14
EMAGE:11872 EMAGE:11872 EMAGE:11872 EMAGE:11872 EMAGE:11872
euxassay_011044_15 euxassay_011044_16 euxassay_011044_17 euxassay_011044_18 euxassay_011044_19
EMAGE:11872 EMAGE:11872 EMAGE:11872 EMAGE:11872
euxassay_011044_20 euxassay_011044_21 euxassay_011044_22 euxassay_011044_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:11872Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
11872_wholemount_strong.wlz
11872_wholemount_moderate.wlz
11872_wholemount_weak.wlz
11872_wholemount_possible.wlz
11872_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:11872_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
epidermis
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
vibrissa
weak weak
regionalweak expression: see section 06 07 08 09 21 22 23
metencephalon floor plate
moderate moderate
regionalmoderate expression: see section 12
spinal cord floor plate
weak weak
regionalweak expression: see section 13 14 15
pharyngo-tympanic tube
weak weak
regionalweak expression: see section 01 02 03 04 05 22 23
naris
weak weak
regionalweak expression: see section 14 15 17 18 19
nasal septum
weak weak
regionalweak expression: see section 14 15
esophagus
weak weak
regionalweak expression: see section 13 14
lower jaw incisor
weak weak
regionalweak expression: see section 12 13 14 17 18
oral epithelium
weak weak
regionalweak expression: see section 08 09 10 11 12 13 14 15 16 17 18 19 20 21
palatal shelf epithelium
weak weak
regionalweak expression: see section 11 12 13 15 16 17
upper jaw incisor
weak weak
regionalweak expression: see section 13 14 17 18
urethra of male
weak weak
regionalweak expression: see section 15
lung
strong strong
regionalstrong expression: see section 04 05 06 07 09 10 11 13 15 17 18 19 20 21 22 23 moderate expression: see section 08 12 14 weak expression: see section 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36577
Entity Detected:Lama3, laminin, alpha 3 ( MGI:99909)
Sequence:sense strand is shown

>T36577
TCTGAGAAGAAACCAAAGGCTCGCTAGCTTCTCTAATGCCCAGCAGTCGCTCAGCATGGGAGGCGGTTAT
TTCGAGGGTTGTATCAGCAACGTTTTTGTCCAAAGGATGTCACAGAGTCCAGAAGTCCTGGATATGGCCA
GCAAGTCTACTAAGAGGGATGCATTCCTAGGAGGCTGCAGTTTAAACAAGCCACCTTTTCTTATGTTGTT
TAAGAGTCCCAAGGGATTTAACAAGGCCCGGAGTTTCAATGTCAATCAGCTGTTGCAAGATGCACCTCAG
GCTGCAAGGAGCATAGAGGCTTGGCAAGATGGGAAGTCCTGCCTACCACCTCTGAACACCAAGGCCACTC
ACAGAGCCCTGCAGTTTGGGGACAGTCCTACCAGCCACTTGCTATTCAAGCTTCCCCAGGAGCTGCTGAA
ACCCAGGTTACAGTTTTCTTTGGACATACAGACAACTTCCTCCAGAGGGCTAGTGTTTCACACAGGCACC
AGGGACTCCTTTGTGGCTCTCTATCTCTCAGAAGGCCATGTCATCTTTGCCTTGGGGGCAGGAGGGAAGA
AACTGAGACTCA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 85681. Forward Primer - name:085681_F_cDNA_Lama3, sequence:TCTGAGAAGAAACCAAAGGCTC; Reverse Primer - name:085681_N_SP6_cDNA_Lama3, sequence:TGAGTCTCAGTTTCTTCCCTCC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:11870 same embryo
 EMAGE:11869 same embryo
 EMAGE:11868 same embryo
 EMAGE:11871 same embryo
 EMAGE:11873 same embryo
 EurExpress:euxassay_011044 same experiment
 MGI:4825858 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS