Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:11879

Ltbp2 latent transforming growth factor beta binding protein 2 ( MGI:99502)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:11879 EMAGE:11879 EMAGE:11879 EMAGE:11879 EMAGE:11879
"Pseudo-wholemount" of euxassay_011131. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011131_01 euxassay_011131_02 euxassay_011131_03 euxassay_011131_04
EMAGE:11879 EMAGE:11879 EMAGE:11879 EMAGE:11879 EMAGE:11879
euxassay_011131_05 euxassay_011131_06 euxassay_011131_07 euxassay_011131_08 euxassay_011131_09
EMAGE:11879 EMAGE:11879 EMAGE:11879 EMAGE:11879 EMAGE:11879
euxassay_011131_10 euxassay_011131_11 euxassay_011131_12 euxassay_011131_13 euxassay_011131_14
EMAGE:11879 EMAGE:11879 EMAGE:11879 EMAGE:11879 EMAGE:11879
euxassay_011131_15 euxassay_011131_16 euxassay_011131_17 euxassay_011131_18 euxassay_011131_19
EMAGE:11879 EMAGE:11879 EMAGE:11879 EMAGE:11879 EMAGE:11879
euxassay_011131_20 euxassay_011131_21 euxassay_011131_22 euxassay_011131_23 euxassay_011131_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:11879Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
11879_wholemount_strong.wlz
11879_wholemount_moderate.wlz
11879_wholemount_weak.wlz
11879_wholemount_possible.wlz
11879_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:11879_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 15 16 17 18 19 20 21 22 23 24
upper arm mesenchyme
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 moderate expression: see section 20 21 22 23 24
upper leg mesenchyme
moderate moderate
regionalmoderate expression: see section 20
anterior naris
strong strong
regionalstrong expression: see section 14 15 16 17 18
external naris
strong strong
regionalstrong expression: see section 14 17
heart valve
strong strong
regionalstrong expression: see section 10 11 12 13 14
upper lip
strong strong
regionalstrong expression: see section 15 16 17 18
thyroid cartilage
strong strong
regionalstrong expression: see section 12 13 14 15
axial skeleton
strong strong
regionalstrong expression: see section 10 11 12 13
basioccipital bone
strong strong
regionalstrong expression: see section 11 12 13 14
basisphenoid bone
strong strong
regionalstrong expression: see section 11 12 13 14
orbito-sphenoid
strong strong
regionalstrong expression: see section 03 04 05 22
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36601
Entity Detected:Ltbp2, latent transforming growth factor beta binding protein 2 ( MGI:99502)
Sequence:sense strand is shown

>T36601
AGATGCCGATGAATGTGTACTGTTTGGGCCTGCTCTCTGCCAGAATGGCCGATGCTCAAACATAGTGCCT
GGCTACATTTGCCTGTGCAACCCTGGCTACCACTATGATGCCTCCAGCAGGAAGTGCCAGGATCACAACG
AATGCCAGGACTTGGCCTGTGAGAACGGTGAGTGTGTGAACCAAGAAGGCTCCTTCCATTGCCTCTGCAA
TCCCCCCCTCACCCTAGACCTCAGTGGGCAGCGCTGTGTGAACACGACCAGCAGCACGGAGGACTTCCCT
GACCATGACATCCACATGGACATCTGCTGGAAAAAAGTCACCAATGATGTGTGCAGCCAGCCCTTGCGTG
GGCACCATACCACCTATACAGAATGCTGCTGCCAAGATGGGGAGGCCTGGAGCCAGCAATGCGCTCTGTG
CCCGCCCAGGAGCTCTGAGGTCTACGCTCAGCTGTGCAACGTGGCTCGGATTGAGGCAGAGCGCGGAGCA
GGGATCCACTTCCGGCCAGGCTATGAGTATGGCCCTGGCCTGGACGATCTGCCTGAAAACCTCTACGGCC
CAGATGGGGCTCCCTTCTATAACTACCTAGGCCCCGAGGACACTGCCCCTGAGCCTCCCTTCTCCAACCC
AGCCAGCCAGCCGGGAGACAACACACCTGTCCTTGAGCCTCCTCTGCAGCCCTCTGAACTTC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 74672. Forward Primer - name:074672_F_cDNA_Ltbp2, sequence:AGATGCCGATGAATGTGTACTG; Reverse Primer - name:074672_N_SP6_cDNA_Ltbp2, sequence:GAAGTTCAGAGGGCTGCAGAG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:11875 same embryo
 EMAGE:11874 same embryo
 EMAGE:11876 same embryo
 EMAGE:11878 same embryo
 EMAGE:11877 same embryo
 EurExpress:euxassay_011131 same experiment
 MGI:4826018 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS